GenePrediction:GLEAN_6936 Details

Name: GLEAN_6936
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:781496..776054 (- strand)
Length: 5443
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:781496..781008 (- strand)
Length: 489
Type: CDS
Source: GLEAN
Position: GCSC_108:780833..780773 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_108:780703..780600 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_108:780105..780091 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_108:780029..779895 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_108:779695..779576 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_108:779503..779236 (- strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_108:779148..779002 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_108:778903..778713 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_108:778228..778118 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_108:778065..777960 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_108:776733..776054 (- strand)
Length: 680
>GLEAN_6936 class=GenePrediction position=GCSC_108:781496..776054 (- strand)
ATGGCGGCCATTGCGTCATCATCATCGGACAAGCAGGTCCCAGTGATTGTTCAGACAGAAGTGTTTGACAATAAGAAAGA
CAGCGTATCGCCCAACGACAAGCCTGGAAATGCAACCACAGGCCAGCCATCAAAAGCACCCAGTAAAATGACGTCAGTCA
AGCTGGCTGACTGGAAGGCGAGACTCGAATCTCTTATTGAGAAGCCGCTCGAGAACGAAAGCCGCGCTGAAATAAAAAAA
CTCCTCAGTCAAGATGTTCAAGTCAAGGGAAATGAGAATTTGGAGACGGCTTTTTACAAGATACTTTCTGCTGTTCTTGG
CAAAGACAAAGACAACGATGGTGTCGTTAAACTTCTCATTGACAGCAAACACTTCAAAGGCAGCTACAGATGGGGCGATG
ATCAGTGCACAGCACTACACCGAGCTGTGCGAAATGGAAGGGATGAAGTCACAAGGAAATTAGTGAAGGAATACCGAAAC
ACCATCAATGTACGCGACAAAAAAAAACGAACTGCTCTCCATTACGCAGCGATGCACGGCTCTGTAGATATGACGTCTCT
CCTACTACACAGCGGTGCTACCGTCAATGTCTTTGACGACAGACATGCAACACCACTACACATGGTTTCACTGTTATCAA
AAAAAATAGACTACCTGAAACAGATCGCCATTGCAAAACAGCTTCTGGAAAATGGTGCCGAAATTAATACCAAGGATGTC
GATGGTGAGTCTGCAAATATCGCCATTACTTCGTTTCGAGCATGCTCTGACCTCGTCAAACCCCATCTCGTAGGTGATAG
CCCACTACACGATGCGGTGAAAAATTCATACCACGAGGTTATCGAGGTCCTCATAGATTATGGTGCCGATACTGAGTACC
GTGACTTTGCGAATAAGGTACCGCAGGATTATCTACATATTCTGTCTGATCCTAGAATCCGTGACCTTTTTGATCGACCT
ACGGGAAGGTCCGCCCGGGACAAGGCTCGTCGAGTCGACTTTAGAATCCCCGACGAAGCGCCGACATGTTGGGGACACCG
GCTGAATGAACAAGACGAAGGATATCGCACTGATGATGATAAAGAAGCAAGTGAAACCGCCAAGGAAGATGTCTGCAAGA
AGTTCTTTGCATATATTCATTTTTTCTACCGGAAAGAGAGCTACTTCTGGACCAGATCGGTGTATATTCATGACCTTCTT
CATGACAACAATCGGACAATGACAAACCTGGAGACCACGTTTGTCTATAAGATAAAAACCGAATTTCCAGATTGCAAAGA
CACCGACAGCGACATTCGAAGCAACGTATGGAAGTGGATTCACATCCCTGAAAACCAGGTAGGCTTCCCTCGGTTGTCTT
GCTATCAAATGAAACTAACGCTTTGGAATAGATGTCCTGGGTCACGGTGCGTTTTTCTGTGTAACGCTGCTACTACGGAT
CCGCAAATCTAACCATTCTTTTCTTAGGACTTGGTGTGGTGTCTCACCCGTGACGACGACGATCCTTCTTTTGGCAAGAG
AAAGGACGCATGGGACTTTCTGACCAGAAATATAGCACAGCGAAAGGGAGTCAGCCATGGCTCATATATGAGAGTGCCTC
ACGTAAGTGCGTGCGGTTTCGGTACTGAGAAAGGGTAGGCGGAATCAACGCTAATATAGAATAGGCGGGAGACTTTTCAA
AAAATAGTGGTGATAGCCCATCAAGCCATCTGCCTCCCATGGGGACACAATTAGTACGAATCGAAAGATCCAAGCTTTAT
GCACAATTCCATTACTTGTACTAATTTAGATAAAATTATAGGATTCAGACAAAGCGGAAGACTCCAACATCCCCAAAAAT
TCCGAGGCTACCAACTTGCATAGGCGAGAGCTCTGGAGAAATGGGTCGAAACTTTCTGATGAAGAGAAGATTTCAATCGT
AGTAAGCTTGTGATAACCCGGACAAAGAAGAAACAAAAAGCACAAGCAATAAGCAGCAGACTAAACGTTCTAGGTGCCCT
ATATCGACTTTGAGACAAAGCACTATCTTGACCGGGACAGTATGCAAACACCCCGGTTCGTTGATAAGCGCCAACTGGAG
GAAACGTCCTTTGAGTATTCTGGCCTATCAGGACTCTATCAGACACAAACTCTAGATCAGTCGTATTACGACATGCTTGA
TAAAGAAGAGTTGAAAATACGTGATCAAGACCAGGTCGTCATGAGATGGTTCAGTGACCTTAACCACGCAGCAGTTGAAA
ACACGATGGAGTCCAAAGACGGTAAGTCACTTTTCTGTCTCCCTAGTAGAAAGCAAAAAAATCCCTGTACTAGCTTTTTA
CTTGCCCTGACGTCCTATGACTGAGCAGGTACATCATCTCTCTACGAAAATGAGACTCGGGACGACGACAGCGTGAATGA
GCCGGGCGACAGTACGGAAAAGGATAGTCCGGTGACCAACGTCGTGGAGAAATTGTTAATGGTTAACCAACTTTGGCTTT
GGAAGCTTGACAAGGGTGAGCAAATTCCATATGTTCCTTTTTGAACTTGGATGTGAATATTTTGTATATTCGGGCTCACT
GAAGTCTAGACACTGTTATCACGGCATTCCCAGACCGATACCATCAAGGTTTCGAAAGCACGCTATTTGAGACTATTCGC
CAGGGCGACATAAGGTCGTACAAAAAACCAGAAGAGCTTATCGAAAATATACTCTTCAAGTGCGTCACCTTCTTAGAAGA
GTTCTGGAACGCTGGGTTGGGTATTCACTTGCTTGACATCTTTGAGATCTCTCTGGCGAAAAAGGTACGTAAGATTCGCG
AGCTTTGTGCGTTGCCAGTATATAAGGAGCTATCTCACTAACTTTGTATTCTACGTGTCTTGAATCAGTCAAATGATGAG
GTTAAATGCTTCAGGGATTTCCAAAAATCTTCAGACGAGAGGAAGCTCAACCTAGCGCAGAATATATCAGTGGAGATGGC
ATCGATCCACGAAGTCAAAGACATTCGAGATGAGCTGCATTTGATTCGCCGAATCTTGGAGCTGCAACATGAAGTTGTCG
ATAAGTTTTCTGACGTCTTCTGGGGAGAAAAAACCCTTGGCAAACATATGTTTGTAAAAGATTGCGGATTGTTACGCTTG
ATTGATCGCGTCAAAAATCTGGACAGATATGCACAGAGAACGGTTGAAGGGGTTTGTATATCTACCTAAACCGCATTCCG
ACTCGACTGTTTACCAGGCGGCCATCGGCGCGTTACATGTTACATGGTGCTAACGGACTATGCCGCAGCTTGATTACTTC
GTCGCGTTGAAGCAAGCGCAAAGCGCTCTAGATGAGGCAATGACGGCTGGTCGCCTCAACAGATACATCATGCTGTTCAC
GCTGGTGACTATTGTATTCGTACGTGCCCTCAACACCAAGCGTCTGAATCCGGCTAATGTGCTATGTGTAGACTCCATTG
TCATTTCTGACAAGTCTGTTCGCCATTCCTTTCGACTACTTTCCTCGGGACGACGCTGGTGTCAGGCTGTCTCCGGGGTG
GACAGCTAAATGGATGGGTAAGCATATTAACCCATCGCTATCTATCGTGCTCTCTCGCCGTACTAACGATTTAAATTTGT
CGCAGCTACTGGTGAGGTCGTTACCCTTGCTGTCGTCGGGTTAACCGGATTTGGGCTGTGGAAGTTAAACTATATCAAGA
GGTGGTACCAAAGATACATACCGGAAAAGTCCAAAAAAGAAACGAGGAAAGAATCACAGGAAGCTTCAAACGGCTGAGCT
TCCGAGATGACGAATTCGACGAGGAGGACGGGATTGCCTAGATATGTTTCAGATCAAATCGTCATGGCTGGTACTAAAGC
CTTCAAAGGAAAAAAAATGCAGTGATTGAATCGAGTCCAAACTGTTGAATTTGGCGCCCATATGCCTCCCATTTATTCCA
GGCCTGTCATGTTCGTAAGATGGAGGCTGCTCTGTGAGGCCCGGATTTTAGAACGTTTTAGTACACGCGCCTGAAGTAGC
CAGTTTCTACTTGTTGCAGAGGCACAAGTCTGCTCAAACTGACATTGTGGTATAAGCATGGGCATCAATAAAGCTTAACG
CTGACAAAAATTGCAAAAAACGTGATCTTGGTTTCGAATAGCCTGTTGAACAGGCGCACCAGGAATTGAGCCCGATGCGG
GGGTCGAACCTGTTAGGTGTTTGTTAGATTGATGACTACTAGTAGTGCATTCCGGTCAAGGTACTCTGTAATACTAACCC
GCAACCTTGAGATTAAGAGTCTCACGCTCTACCGATTGAGCTAACCGGGCTTAGCTTGTTGGTTTCGGCGCAGGCGTAAC
AAGCCTAAGTAGGGGACTGATTTGTAGTAATGAATTCTCAGGAATGATCCTTATTTTCCCGTGCCTCGTGCGTCATAAAA
ACTCCTGGGAAGGGATGCTGCCATGTCCTTTATTATATCAAAGTAGACGTTGATCGAAAGATTTTGGCTTCAGATTTGAT
TCAGGAAGGCAACTTTCCTAAATAAGGAGTAGGTTACCAGGAGTCTGTAGCTACTACCAGCAAATGTCACATAGCCCATG
CTGAGATTAAGCAAATGTCACTACTGACCACCCAAAGTCCAGTCAGTCTGTCTTTAAGGCTCGCACCGTTTTCGAATACT
CTTTCAGCAGCCAGTTACCCACAACTCCCGCAACAGGTGATATTTCTTTGAACTGGGCAATAAAGGTGTCGATAAGAATT
CCCATCTTTTCCAGCTCACTCAGCACTAAATGCCGCCGGATAGTCGCCTGGATCTTCTCGTCCTCGATTCCAAAGGTGCC
CAGCGCTGCTGGCACACTCGTCACAACAAATCCGGTCGTCTGCGGGAAGGTTCGTATGCTTCGTCTGGCACATTCGGGGG
CGCTTTCTCGTGACGGAGAAGACGACGGGGAAGACGTGTTCGAGCTGTCGGAGGAGCACACGGCAGCATCGCCCAGCGTA
GACTCGGCGGGTATGTCGCATGTCCATCCGGCCGCTTGTTGGTACCAGATGAGGATGCGTGAGATGGTGGCGGCGTGCAC
CATGATGCGGTGGACAGGACTGTGCGCATGGGCACGCGAGAAGCTGGTCAAGTCGCTCGATGGCCTTGCGATTGAAATGA
AGTACCTGGTCCAGCTGTGCCGGCACCGTGGCCATATTGGTCTGCGGGGCGTGGAGATCCGGCGCCGGGCAGATAAGGTC
CGCAAAGATTTCATAGGACTCACGGGCGCAACTGTGGGATGTGCAAGGCATCTTTTCAGGCTCCCGGCTCATCAGAATAT
CTCCTGTCGGGGCATCCGGGGAGGGCAGCATATGCATGCCGACATCCATGACGCCGAACTGAGACCACTCTTGGCCAAAG
AGATCGAGACTGAGATCCGGCTGATCACCACTCAATGGAAGGGCCAGGCCCGACCCCAGATCTGGCTGATTTGTTTAGAG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62