GenePrediction:GLEAN_6937 Details

Name: GLEAN_6937
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:774793..773390 (- strand)
Length: 1404
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:774793..774680 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_108:774636..774464 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_108:774399..774336 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_108:774273..774246 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_108:774185..774173 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_108:774122..774033 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_108:773966..773390 (- strand)
Length: 577
>GLEAN_6937 class=GenePrediction position=GCSC_108:774793..773390 (- strand)
ATGTCCACAAGCGTTTCGTCCCCTGCCGCCGTCGTGCCACCGGAGACAGAACCTACGTCTGTACCGGTGGAAGTGGCAGC
GGTCCTTCCTGGTGAACACTGGGATGAAGCCCCGGTAAGCATTGAAACTGCGTAAACTTCAAACCTAACACTTGTAGGAT
GACTACGATGACGACTTGGCGGTCAATGATGTTCAATCTTCGACCGCCTCCATTACCTCGTCGATCCTGAACTATAGGAC
GTTTAAAGGCCGCACGTACCACAGCGATCGAGGCACTGCTCAGTACTGGGGATCCAACGATGGCCGGCATAGCGACTCTT
TAGACATGTTGTAAGAACTTCAGATTTGTACCAGAGCCCGCCCTTTGCAGGCATTAACTCACTCTACGACTCAGCTACCA
TGCAACCTCCCTCCTCTTGGACGAGAAACTGCATCTGGCACCCGTTGAAAATCCAAAGGTGTGCTCTTACAATCAGAAGG
TGTCTCACAATGGTTGCTAACATAGACCAATCAACTGTAGAAAGTGCTGGACATTGGTACTGGGACGGGTAAGCCTAAAT
AGGATTGCCGTCAAAGTATGGTCAAGAAACTGACGGACATTCGTCTAGGCATCTGGGCAATGTATATCTCCCCCTATCTG
ACGCAAAAAAGCTTATACGCTAACAGCACAGCGACTTTGCCGACGCCCACCCTGAGACCATTGTAATCGGTACAGATGTC
TCGCCTATCCAGCCTACATGGGTGCCGCCTAATCTTATCTTGTATGTCCGCTTGTACCACAGCTTGTGAAAATGATAGCA
TCTCTTCAGCTTACTAACATGGTGTAGCGAGATCGAGGACTGCACTCAGCCTTGGACCTTTACCCCCGGCAGCTTCGACT
TCGTCCACATGCAGTTCCTGGTCGGCAGCATCCCGGACTGGTATGCCTTGTTTCGGGAGGCGTACACCGCTTTAGAGCCT
GGAGGCTACCTCGAGAGCTTCGAGTCGTCGCCTTTGACTCACTCTGACGACGGTTCTATGCCTGCCAACTCGGCGAATGC
ACAGTGGGGTCCTATCTTCTTCCAGGGCGGCGATAAGATTGGCCGTACAGCCCGTGTAATTGAGGACGACATACAGGTGA
AGGCCATGGAGGCGGCCGGTTTCGTCGACATACAGGTGACGAACTTCAAGTGCCCTAGCGGTATCTGGCCCAAAGACAAG
CGCCAGCGCGAAATCGGCGAGTTGATCATGTACAGTGTCCTAAATGACGTGGAAGGTTGGATTCTATTCATGTCCAACAC
CCTCGGCTGGACACTGGAGCAGATTATGGTGTATACTGCCCACCTGCGCCGCGAATTCAAAAAGGGCGAATACCATTGTT
ACATACGGCAACGCGTGGTATACGGCCGTAAACCAAAGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62