GenePrediction:GLEAN_6938 Details

Name: GLEAN_6938
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:772451..771662 (- strand)
Length: 790
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:772451..772365 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_108:772287..771999 (- strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_108:771849..771662 (- strand)
Length: 188
>GLEAN_6938 class=GenePrediction position=GCSC_108:772451..771662 (- strand)
ATGGATAGCCATGGAACCGGAATGCCACTCTGGGCGGGAAAAGATGACATCAAGGAGTATCTGAAGTTGGTGAACAGAAA
TGGAAAGGTGGGATAGTGGGGGCTTCGCCCTTTCAACGTTTCTGCCCTTTCTGTTACTATAGTCTGACACTCCGTCTACT
ACAGGCGCTGGAATACTGCATGTTTCAACCCGGGCTTTTTCTCAACTATCTCGCAACTCCTCACCGGACAGCCGAGTACC
TGACACAGTTGAACACCTTTGCTGATCTTGAAAATCGTCGCGCCATCGTCATCGATGAGCTAGACCCGGTCGTCAGCATG
ACGACAGTTCAGGATATGGCGGCAGTTCTGGCACGCGCTGTGGACTTTGAAGGCGAGTGGCCCGAAGTCGGAGGCATCCA
AGGAAACAACCTTGCTATCTCGGAAATCGTTGACGTTGGCAAACGTTTGCGCGGTAAGTAGCATATATCAACAAATGGTG
TGTCTTGTTGACAAAGTACTTACACATGTAGGAGAGCCCTTTTCGGTTCAGGCGGTCAAAGTTGAAGATCTTGAAGCTTG
AAGGCTCACAGCATCTTGGAAATTGGGGGTGCGCCACCATAGCGTTTCGCCACCATAGCGTTTCAGAAGAGGAGGCAGAT
AAGATGTTTGAAACGGTCCTTGTGGGCATACTTCTTGGCTGTGCCAAAGGTGCCTGGGAAGTTTCAGACGAGTGGAACAA
ATTGCTGCCAGACTTCAAGTTCACCAAGGTTGTGGATTTTGTGGCGGACGTATGGAGCGGAAAGCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62