GenePrediction:GLEAN_6939 Details

Name: GLEAN_6939
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:767980..764915 (- strand)
Length: 3066
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:767980..767973 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_108:767889..767643 (- strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_108:767578..766864 (- strand)
Length: 715
Type: CDS
Source: GLEAN
Position: GCSC_108:766805..765563 (- strand)
Length: 1243
Type: CDS
Source: GLEAN
Position: GCSC_108:765371..764915 (- strand)
Length: 457
>GLEAN_6939 class=GenePrediction position=GCSC_108:767980..764915 (- strand)
ATGGCCTTGTAAGGAATTCCTGGACGCCCGTCTCTATCCTTGTCCTCGCCGTTCCTGCTACATGCTAACCCTGTTTTGAC
TGTTTCCTCAGCCTCAAGTCCAACCAGCTTTCCATTCCCTTTCGCCAGTCAGCGCACCTCTCGCTCTCGAACTCGCTCTG
TCGGTATATCACCGACAAGTACAATCAACATCCCGACGTGTTCCGCGAGGACCTGAGCGTTATCGACGCGCTACGCCACG
ATGCCGTGAACGTCTACGAGGCCCATCCCAGCGGCATAAAAAAGCTGCAGGCGTATGCTGCACAGCTCGCTTGGATTAGC
GGAAAATTCCCGGTGGAGGTGCGTTGAAGACTCACCCAAAAGCCTCTGATGCCACCCTTGTGCATCACACTGATAAATCT
AGGTCGGCGCCGAGTTTACGTGGTACCCTGCCCTCGGCTACAATGTCGAACGGCCCATCGTCGAGGACAACCTCCAGTTC
GAAATCATCAACATCCTCTACAACCTTGCGGCCCTCTACTGCCAGCTGGCAGTCGGTACGAGCCACACGGACGCAGATGG
CCTCAAGGCTGCAGCTAGCTACTACGTGCAGGCTGCAGGCGTGTTCAAGCACATCCGAGAGAAGCTGCTGGTTGATCCCG
ACGTGACGGCAGCGAACCTGCCCGACGACCTCGACGCCGCGACCCTTGACGCGCTGGAGGAGCTCATGTTGGCACAGGCG
CAGGAGTGCTTCTGGATGCGCGCAGTCAACGAGCGGTACAAGGACGCGACGATCGCCAAGCTCGCCGCGCGCCTGTCGGA
CCTCTACAACGCCGCCGGCGAGGCTGCCGTGCGCAGCGACGCTATCAGCCGCGCCTGGATCCACCATATGAGCGCCAAGC
ATCACCACTTTGCTGCCGCTGCACAGTACCGGGCGTCGCTCGACTGCCTAGAGAAGCGCCGATATGGCGAGGAGGTAGCC
CGGTTGCAGGACGCGCTGCAGTGTGCGACCGAGGGTCTGAAGGAGGGCCGTGGCGGCCTTCTGAGCAAACCGGTGCAGGA
AGATCTCCAGAATCTGAAGAAGCGCGTGGAGGATGACCTCAAACGTGCAGAGAAAGACAACGACATCATATATCTGAGTG
AGTGGACCCAGGCGGCTTTGATCTCTCCTTTCCGGCGTCCGCTGACCGATCCCAGACGTCGTGCCTGCAAAATCAGAACT
GAGGATCCTCGACCGTGCCAGCATGGCCCTTTCCCGAACGCCTCCACAGGTCGAGAAGCCGTTGGACTTTCTCGGCGACG
GCACAGAATTCGGCACTCCCCTCTTCGCAAAGCTCGTGCCGTTTGCAGTTTACCTCGCCGTGTCTGTGTACGAAGAACGA
CGAGACCGACTTGTGAACCAGAACATCATACGCGACCTGGAGGCGTTGACAGAGCAGCTGCACGAATCGTTGATATCGCT
GAACCTTCCCGGCTCTCTGCAGGCCATAGAACGGCCGCTCGGGCTGCCCGGAACGCTGTCGCAGCATGCGGAGGAGATTC
GGTATGCCGACGTTCTGAACAAGGTGCAGCGCAGCTTTGCCGACATCGACAAGCTTCGGGCGAGCGACCGAGCGACATTC
GACGAAGGAAAGGCCATGCTAGAGGTAGAAGACGACGAAGACACGCAGCTGCGACAGCGGCACGGCACCGAGCGATGGAC
ACGGCCAGAAGGCAAGGCAGACGCGCAGGGCCAAAAGCTGTGGAAAAACGCAGTCGAGATCGAGGGTTACTTCAGCTCCA
GCGGGTCCAGCGACGCGGTGGTGCGCGACATGTTTGCCTCGGTCAAGGACATGCTGGGGCTTCTGGCGGGATCGGACCGA
GCACTGCTAGACTTTGTGCCGAACAGCCGGAAGGTGGACATCTCGGAGATGGTAAAGCCAGCGCTGGGACGGCTCCGAGG
CGTGTACAATGACGTGCTGCGGATGGAGTCGCGGCGGCGGAAGCGCGTGGAGATGCTGCACGAGAAGGCGCGCGGCGACG
ACGTGAAGCCAGACATGATGAAGGAGACAGCACGACTGGAGCGGACGTACGCGAACACGCCGATCGTGGCGTCCCATTTT
GACAGCTTCTTCGCCAGCCGGCTGCGCGACCTCTACGGCGAGGACCAGGGCGTCGTCGACAAGGAGCGAGAAGAGCAGGA
GAGGCTGCTCGAGGACGTGGCGCGAGCGAACCGCGACTTTGAGGCACAGAAGCGGGCCAGCGGCGACCGCGGCAGCCGCG
AGCGCGAGGCGGTGCTCCAGAAGCTGGACACGGCGTACTACAAGTACAAGGAGATCGTCAAGAACGTGGAGGTGGGCCGC
AAGTTTTACAACGATCTCGGTCGCATCGCGGGCTCGTTCCGGGACCAATGTCGCACTTGGCTGCAGCAGAGGCGGGCAGA
GGCCCAGAGTTTGGAAGAGTGGGTGTTCCTGCAGCTTGTTTTTGCGGATTTTGTGCCTTCTTTCCTGTCGTGTCTTGATT
TCCGAAACTTTCCTCCTGTCTGTCTCGATCAAGTTCAATCTTGTTTGCTTTGCTTGTTCACCTCTTTCTCCTTCCTTCTT
CCACTACCTCCTTTTTCTTGCCTAGGACCCGCTAACTAATCTGTCCTAGGGAACTCTCCATGCCCGTCTTATCGTCCTTG
TCGCTTGATCAGCGGTCAGCGCAGTCCTCGGTGCCACCACCGCCAGCACCAGCACCAGCGCCGGCTCCAACGGTCCAGCA
AGTCTCATCCCATGCATCTCATGCAACTCATGCATCACTATCGTCGCAAGATCAGAGTGCTATGCCTCCACCTCAACAGC
AGTCGTCTATCCAGTCTTGGGCCACCAGCGGCCCACCACACCATCATCTCGCCATGTTCCCGCCGGCCATACAGCAACAG
CAGCAGCAACAACAGCAACAGCGGCAGAATCAAGCACCACAGCAGCAGACATGGTCACCCGGAGTTGCCATCCAGTTCGG
AACACCAAGCATGTCAGTGTCACAGCAGAAAATGCCTGGTGCTAGTGCGACTGGGAACAGGACGCCTGGGACATGGGACC
CATCGTCGGGGATTCGTTTCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62