GenePrediction:GLEAN_6940 Details

Name: GLEAN_6940
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:762502..760726 (- strand)
Length: 1777
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:762502..762115 (- strand)
Length: 388
Type: CDS
Source: GLEAN
Position: GCSC_108:762067..761260 (- strand)
Length: 808
Type: CDS
Source: GLEAN
Position: GCSC_108:761140..760726 (- strand)
Length: 415
>GLEAN_6940 class=GenePrediction position=GCSC_108:762502..760726 (- strand)
ATGGAGAACTTTACACTCTTCTTACTCTATCTGGCCATCCCTGGCCTGCTCTTTTCCTTTCTACAGCAGATGCGCTTGTG
GGCAAAGATGAGCCAGATCCAGACAAGCAAGCAGGCATTTCCAGGACCCAAGCAGTACCCCATCGTTGGGCGGATCCATG
ATCTGCCGCGCTTCTCGCTGTGGCTCAAGTTCAAAGAGTGGGCCGACGAGTTCGGCCCTATCTACCAAACCCGGGCCGTG
GACCAGACCTTTATCATCATATCAGACGAGAAGATTGCCGAGGAGCTGTTGGTCAAGCGTGGCCACATCTACTCAGGGCG
TCCGCAGATCCGATCGCTGATTCGCCATAAGGAGGGTCCGGCCTACTCGGCCCTGATGGATCGACATGGTAAGTCTCTCT
CCCCCCCTCCCATCTTCTTTGTGCTAATGTGACAGACATCTGGCAGCGCCAGCGCAAGTGGGTGCACGCGGCCATGGCAG
AGGCGCACAAGCACCACTTCTACGGGCACATTGAGGCAGAGACGGCGCGGCTGCTGGCGATGCACATCCTGGACCCGGCA
CAGTTCCTGGACAATACGCGTGAGTACTGTGGCCGGATCATGTCGCGGCTGTCGTGGGACGACGCGACGCAGGGCCGGGT
CAACGGCGACAGCGCGGACCAGACGCTGCACTGCATGTCGGTCTCGGGCCCGATCACGAACACGATGACGCCGCTGTGGC
ACCTGCCGCTGTTTGCGAACCCGTGGAAGCGCTTCGAGATCCGCCGCGAGGCCGAGCAGCGGCGCTGGTGGCTGGCCAAC
CTGCGACTGGCCCGCGCCCGCTACCTGCGCGGCGAGCTGCCGGCCGACACCTGGGGCTACCGCTACTTCCAGCAGGTGCA
GCGCGCGGGCAACGTGGCGCTGGAGCAGGAGCTCGAGCAGGAGACCTTTGCCAGCTGCATGATCGGCTTCTTCAACCTCG
TCGGTGTCGTCACCATCTCGGGCCCGCTCAAGTTCTTCATGATGGCCATGGCCCTGCACCCAGAGTGGCAGGCCAAGGCC
CAGGCCGAGATCGACCGCGTCTGCGGCGACCGCATGCCCACCATGGCCGACTATGCCAGCCTGCCGACCGTGCGGGCCTG
CATCAAGGAGACGCTGCGCTGGCGCTCCGGCGTGCCGCTAGGCGTGCCGCACCAGGCCGAGCGTGACGACGTGTACCGTG
GCGTCGAGATCAAGAAAGGGACCATCGTCCTGGCGTGTGAATGGTAAGTGGAAATGAAATTGAGAGGAAAAAAGAAAAAG
AAAGAAAAAAAAAAAAAGAAAGAAAGATGCCAAGAAAAGAACATCGCAAACCCCCTGTTTTACATAACACTAACATCCCT
AGGAATCTCAATCGCGTCGCGTCAAGGTATCCCGACCCAGAAAACTACCACCCCGAACGGTATCTGGAAGAGGGCTGGCC
GACGTACATGGAGCCGCTCTCACGGTACCCCAACCTGCGCGACGGCGCCTCCATGCACACCTTTGGCTGGGGTCGCCGCG
CGTGCCTGGGCAAGGACATCGCCGACGACGAGATCTTTGTCTGTGCCGCCGGCCTGCTCTGGGGCCTACAGCTAGCCCCC
AAGATGTGTCCCGTCACCGGCAAGGCTGTTCCCATCGACACGCAGGCGACCAACTCGCACGTCATCCTTGAGCCCGAAGC
ATACCAGCTGAGCATCCAGGCGCGCTCACCTGCACGGGCCAAGAACATCCTCGACAACTACGCTGCCGTGCGACACCAGT
TGCGGGTCGAGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62