GenePrediction:GLEAN_6941 Details

Name: GLEAN_6941
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:755675..751511 (- strand)
Length: 4165
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:755675..755439 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_108:755372..754266 (- strand)
Length: 1107
Type: CDS
Source: GLEAN
Position: GCSC_108:752741..752427 (- strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_108:752230..751511 (- strand)
Length: 720
>GLEAN_6941 class=GenePrediction position=GCSC_108:755675..751511 (- strand)
ATGTCACTGAATCATGACATCAGCAGCGATCTCCACTTGGCAATCAGCGAAACATTCATGGAGAAGCAATGGGCAGTTCT
AGTACCGAACTTCGATGACGACGTAAGGGTGTTGGAACTCGATATGAAACAACCTCTACCTTTTACTCACGTGGAAATGG
AAAAGGCCAGCGGCGGCTTCAGCACAGTGCATAAAGTCGTCGTACACAAGGAGTTCAGGAAGTACAAGACTTGCAAGGTG
AGTATGTGGTTCAGTGTGGTATAGGCCACGGGACGTATAATCTAACATTGTCTCCTTATCCAGGATACTAGGAACACGGG
CGAAATTGCGTTGAAGGAAATTGTTTTCGAAAATGGTGGATTTGATAAAGAAGTATCGGCCAATATCGAAATTCGAAATA
TCAGACACAAAAATATTGTCGAGTACATCGGAGCAATCCATCGCGGTAATAATTACTACCTTTGTTTTATCTGGGCGAAT
GGACATGACCTGGGGACATATTGGAATGCAACCAGAACCCCCCACCTGTCCAGCGATTCCGTAGAATCTGCCATCCGGCA
GGTTCGAGGCCTCATGGACGGCTTGGACAGTCTTCATCATATAAGTGTTGACCATCACTTCCGGCACACGGACATCAAGC
CAGCCAACATTCTCAGATTTGTCAGAGACCCCGGGCGGGATTCAGAAAGCATTGGGACGCTGAAACTGTCCGACTTTGGC
CTTGCTCGGCGTCATACAGAAGCGACCGAGAAACGCAACGGCACAACGGCACAAGCAGCGACCACTCGGTACTGGCCGCC
CGAAGCAAAATATCGCTCCGACAAAACCGGATTGACCCGCCGGTACGACGTGTGGTCAATGGGGTGCGTCGGGATCGAGC
TCGTCATCTGGCTCCTGAGAGGCACTAAGGGACTTGACCAGTTCAACCGGTCGCTCGTCAAGGACCAATACTTTGAGAAG
TCCACAACAAGCCAAGCAGCAGACAGGATTGAAGTCCACTATAATGTCTCCAACATCATCACTACAATACTAAAAGACCC
GGGGTTCCAGGGGAGGACTGCGATAGGTGATTTCCTGCAACTCATCCAGGACAAAATGTTGGTCGTCAACATCAATCAGA
ATCTCGGCTCCAACCTGGAAGTTCCCAACTCCGGCTTAGTTTCGGCTTCGTCTAAAGTCCGTGCCACTGCAGCGGAGCTG
GTGAAAGATCTCGACCTCATACTTCAAGGACATGGTGGTAGTAACTACTGGTTCACGGGCAAGATTCGAACGCCGTCTCC
AGCCCCGGGCCCGACCCCCAAGATAAAACCACCAACCCTGACTGTGACTGTGGATGACTATGACCTCCACGGGCTGCATC
CCAACGCTGATACCTCCCACGATAGCGGACGGCGGGGTCAGACGCACCATGTAAGCCCCCAAGTGAGATTGCAGGGTCTT
CGGTATCTGGTTTCGTGAAGCTAATCCTACAATCTTAGAGTGTAGGCCTTTCGCCCAATAGTCACACTGACACACCGCGC
TAATGGTGCGAGTAGGAAGTAAGCACATAAAATGGCGTAGAATTTCTTGCCCAAAGACAGAACGTAGCTGACGCTGAATT
AGTATGTAAGTCGTTGTGCAGAACACCTGGATTTGTTTTGTCATAGCTGGTTCTTGAGTCCCTTGGGAATCCTTGATGTT
TGATGGTCAAGTCTGTTGTGGGAACTTGTCAGTGGCTATCCACAACATTGGTAGGATTGGTAAGGGCATGCTTGTCTGAT
TAATTTGTGTTGACTATCGCGATCTCATCTCTGGTGCAAAGCAAGCATGCCATTTTCTAGTCATTGTTTTTGCGCCTACT
CTCCTCATCTCTAACTATACTCATGCGTCTATTAGACCGTTAGTTTATCCGGCAACGCCTTTTAAAAACGTCTAGTCATT
GACTGCATCAGATTGCAAGTGCTCTCACCTAGGTAATATAATAAACTGTTAACTATAACAGAAGCTAAATACATTGTCTA
GATTGTATGCGCCTTCGTTCTTCTCTACACTTTGTCATTACTAACGTATCCATAGGGTCAGGTAGGTTCTGTACCAGACA
ACAGCATAGGCTCGTCATGGCTGCTCCTATTAACAAATTGCATCAGCTCGACGATGCGTGGAATTTTCACCTCGACAACG
AGTTTGCAGCCATGGTTCTCCAAACCCACGAGCACAGGAAACTTTCGGCTTCGGGAAGAAAGACATATCTTTGTCAAAGG
TGCAGAGAACTCGATTTCAAGCACGTTTCCCTTAGCTTCGACGACACGTGGAAAGACCTGGAAGCCAGATGTGCCAATTG
TGGCTTCTGCGCTATGCGCTGGAAGCTGTGCAAGGACTTGCGTCATATACGCACATTTAGATTCGAGCGGAGCGGATCTC
GACTAAAGTTGAATGGGAGAGACGTGCTTACCATCTGTCGCGTTATTGGTAATCTGGCCATCGTTAGGACACAAGTTTGT
AGTCATAGCAAAGGCTGACCAGAAACAAGGCGCAGGCGGACTGCATGACGAAGCCCAGATACAGATAGGCCTCCCCCGAC
TTCCATCAGCGGGAAGTCCTGCCGCCATGAGGACTATTAAGGAATGGTTACGAACTTGCGACGAGAGCCACCCGCAATGT
CGTGTTATTCGCAAGCAACCCTCCACTCTTCCCACGCGACTACTTGATGTGGGTGAGCCCGGATCTCTAAATGTGCGCCT
GTATGAGCCGAAGAAAAAGGATAACGTCAGATATGCTGCTTTGTCTCACCCATGGGGACAAGGGCCACATTTTTGTACCC
TGCCGTCCAACATCGAGCAGTTTAAGAAAGGTATTGACTATAAAACGCTACCAGCGACTTTTAAGGACGCTGTACTTGCT
ACGCGCTCAATCGGGTTGCGATACATTTGGATCGACTCCCTGTGCATCATCCAGGGCCCTGGTGGCGACTTTGAGCAAGA
AGCCCAGAAGATGGAGGACGTCTTTAGCTTAGCTTACTGCGTTCTGGCTGCATGCAGTGCCCGAGGCCAGAGCGATGGCA
TGTTTTCGCCTCGACCGGAGCGGCATGTCGTGATGCTTGCACAGATAAACAAGGTTCCGATATACGTGTGCAACTTTATC
GATAACTTTCAGCATGACGTGCTACAGTCAAACCTTAGCGGCCGCGGATGGGTGCTGCAAGAACGAGCGCTTGCCCGTCG
GACCGTCTACTTCTCCCAGACACAGCTCTACTGGGAATGCGGAGACGGTGTTCGTTGCGAGACTCTTACAAAAATGGACA
AGCAAGTTGCTTTTAGACATATCACAATCCGTTAAGAAAAACAGAAGGCACTACAAGTGCCGAAACTAATGATTAATCTT
CTTATTTAGCAAACTTGCCTCCTTCTTGGGGGACCCGAACTTCCCTTCCACGATCTCCGGTGCGAACTCACGGCGAGGAG
AAAAGATCAAGCTTTACGAAGGCCTGTACCGTCAGTATTCACGGCTTCAATTTACGCATGCTACCGACCGTCCGGTGGCC
ATAGCCGGTCTCCAGCAACGCCTAATCCGCGACTTGGACGCCGTCGGTGGCTTTGGCATCTTTGATGACGGGCGAAGCCT
GCTGCAACACAGCCTTCTCTGGCAACGCGGTCACGAAATCAGAACACTGACCAGGATCGACTTTGGGTCAGGCCGGGCGA
TGCCCAGCTGGTCGTGGATGGCGTACCACGAAGGAATCGACTATATTGACCTGCCATTAGGTAACGTCGAGTGGCTGCAG
AGCGAAGTCTACAGCCCCTGGGCCAACTCTGGCGCCCTGGTCTGGAACACCGAGTTTGCAAAGTCGTCGTTGGAGATCGG
CATCCGTGTACGCGAGTTCCGAGTCGACTTCAATGTCAACGTCAACGCCAACACCACGCCTGCGGAAGTGGCTCAAGCGA
ACATCGTGTATGATGCGCCTGATCCGTCGAGAACGAGCACAGGAACTATCTTGTGTGTGCTCATGGGCAAGCTACGGAAA
GGCAGCACGGCGGGCAAGCAGTCGACCTACTGCGTCCTGCTCGTACAGTCTCGAGGATCGCGTGTGCGAATGGGAGATCA
AACATACGAGAGAGTGGGAGTTGGTCTTCTGTCCGGGATGCTGATTGATCTGAAGTCGCCCGGGATCTTAGCCAGGCTTC
GGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62