GenePrediction:GLEAN_6943 Details

Name: GLEAN_6943
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:748043..746973 (- strand)
Length: 1071
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:748043..747439 (- strand)
Length: 605
Type: CDS
Source: GLEAN
Position: GCSC_108:747378..746973 (- strand)
Length: 406
>GLEAN_6943 class=GenePrediction position=GCSC_108:748043..746973 (- strand)
ATGATCATTGGACGAGGCCTTCTGGGCGGCATTGCCACCGATCTAGAAGACGGAACCAAGCACCTGCTTACAGCTGCACT
TCCCGGCATTGTTGTACCACCGACAACAACGGCCAGTGCGAGCTCCGTTTTCGAGAGCGCCGCATCCGAGAGCACCAATC
CCACGAGCACCTCCAAGGCGAGCCGGATCACAGCCAGCGCTGACGGCGGCCTCACCAACAATGCTGGCAATGGCAAGGGA
AAGGGCAACGGGGCAAACACAACCACTTCAGAAGCTGCTAGCACCGAGAGCATCTCAAGCCAATCAGCACCAACATCATC
CGATGCCATGACAACAACATCCACGTCTGCTTCTACGAACGCCGCTGCCACCACATCTCCTACCACGTCTTCTACTACAT
CTTCTACGACGTCTTCTGTCGCCTCTCCTTTCGCCTCTTCCAGCAACACTTCCGCCCACTCTTCTGCCGTCTCTTCTTCT
GTCTCTTCGGTCACCTCCTCTGCCACCTCTACAGCTGCCTCTACAACTACCTTTTCTACTTCTACAATCGCAAGCTCCAG
CACGACACTGTTGACATCCGCCAGCGCAGAACCAGCGTCGACAAGGTCAGTTGCAGACTTGCTGTCACTCGCTCCGTGCT
TTTGATCCCTGCTAACGCAACCCAGTCCCGCGTCGTCTGCCAGCGCCACGTCCACGTTCGCAACTATTGTCACTCGCAAG
CCGGCCGTCGCCGCCACCACGGCCTCGCCCATTCTCTCCCCCGCAACTGCCGTGTCTTCCATCGTCGCCACCATCTCGGC
CGCTACCACATCGCTAGCGGCCGAGGCTGAGACCATAGAAGCCAAGGCCAAAACTAGCAGCGGCGGCGGCGGTGGCATGT
CCAAGTCCATTTTGGCCGTAGTCATCACCGTGCCCATTGTAGTGGTAGCATTGGCGGTCATTGGCTTCATGCTGTTCCGG
CAGCGCGCCGGCCGCGGTTGGCGCAAGAGGAACACGAGGGCGTACGATGAGGAGTTTGAGAGCTTGAAGAAGAAGCACAA
TGAAAAGTTCAGCGTCACGCAAAACTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62