GenePrediction:GLEAN_6944 Details

Name: GLEAN_6944
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:746517..745636 (- strand)
Length: 882
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:746517..746220 (- strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_108:746150..745636 (- strand)
Length: 515
>GLEAN_6944 class=GenePrediction position=GCSC_108:746517..745636 (- strand)
ATGGTTGCAGACACTCTATCACTCGCGGGCAAGACAGCCATTGTCACTGGTTCTGCCAGAGAGAACGGCATCGGTGCTGC
CATCGCCACGGTCTTTGCCCGCAACGGTGCCAGTGTCGCCATTCATTACAACTCGGACAACTCCAAGCCCCGTGCCGAGA
AGGTGGCTGCCGAGCTGTCCAAGGAGTTTGGAGTCAAGACCATAGTCCTGCAGGGCGATGTGGCAAAGCAGGACGCCGCT
TTTGGCCTGGTTGAACGGGCTCTAAAGGGCCTTGGCACCGGCCACATCGATATTCTGGGTGAGCAACGCTTGCTTCGTCG
CACAGCTGTGTTGCTTTGTACATCTCGTAGCTGACCCTCTAATGCAGTGAACAATGCCGGCTATGGTGCTGGCACGCCCC
TCACCGACCTGACACCCGAGGAGATCCAGGTCGAGTTTGGCGTCAACACTTGCGGCTCTATCTACATGACGCAGGCTGTC
GTCAAGGTCGGCAAGATGCCGCCCGGCGGCCGCATCATCAACGTCGGCACCATTGCGTCCAAGCTCGGCCTCGCACAGGC
CGGTCTCTACGCCGCCACCAAGGCCGCACAGGACAGCCTGACGGCCTCGTGGGCTGGCGAGCTGGGCAAATCGCATGGCA
TCACCGTCAACACCATTGCGCCAGGCCCTGTGGCCACGGACCTGGCCGCGTCGATTCTCGTAAACAAGGACGGCACGCCG
ACCAACACCCAACAAACCATGCTCGGGCAGACACGCGCCGCAGCCCGACTTGGCACAACACAGGATATTGCCGATGCAGC
TTTGCTGCTTGCCTCGGAGAAGAGCCGCTGGATTACCGCGCAGTTCATCTCGGTCAGCGGCGGCATCACTGGCACCATGT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62