GenePrediction:GLEAN_6945 Details

Name: GLEAN_6945
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:740713..737849 (- strand)
Length: 2865
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:740713..740594 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_108:740539..740517 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_108:740467..740351 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_108:740294..739729 (- strand)
Length: 566
Type: CDS
Source: GLEAN
Position: GCSC_108:739654..739453 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_108:739166..737849 (- strand)
Length: 1318
>GLEAN_6945 class=GenePrediction position=GCSC_108:740713..737849 (- strand)
ATGGGCAACCAAGCAGCCTGGATCGAGGGCAATGCAGATCACCCGTTAGTGGTCAAGGAGGCACCCAAGCCAAAGCCAGG
CGCCGATGAGGTGCTCATCAAGACGGCGGTCGTCGCCATTGTGCGTTTTTGTCTGGCCTGAACGGTGTCTACGGAAAATG
GCTAACATCTTCAGAACCCGGTCGACTACAAGCTGCAGTATGTCGTCTGCCAGACACTGATGCTTTAGGGCTGACAAAGC
AACCAGAGACGCGGGCGCGTACTCGCCAAGCAAGCCGTTTATCCTCGGCGAGGACGGTGCTGGCATCGTTGAGGAGGTCG
GAGCCGACGTCACGGGTATCAAGAAGGGCGATCGGGTGATTGCGTAAGTCTCGCCAATCTGCAGCCGTTCCGGCCGTTCC
GGCTGACTCGTCTCCACAGCTACGCCGATGGGCTCGGGTCGAACAAGTCGGCCAACTCGTCTTTCCAGCTGACCTTTGCG
GCCACCTCCCGGCTCGTCAGCCCGGTGCCGACGTCGCTGGCGCTGGAGAAGGCCGTCGTGCTGCCGCTGGCGCTGTCGAC
CGCAGCAGCCGGCCTGTACGACCACACTCTACTGAAACTGCCGCTCCCGGTGGCGGACCCGGCTGCGGTCGTGCAGTCAG
GCCGGACGGTCCTCGTCTGGGGTGGCTCCTCGTCGGTCGGCAGCGCGGCCATCCAGCTGGCCAAGGCGTCGGGTGCGCGT
GTCGTCAGCACGGCGTCGCCGCAGAACCATGCGCTGCTCCGAGCACTGGGTGCCGACGCGGTGTTTGACTACCACGCTGA
CACGGTCGTCGATGAGCTGGCCAAGGAGCTCGAGGGCGCTGACTTTGCGGGCGTGTACGACGCCATCTCGCTGGCTGCGA
GCACGGCGGCCGTGGCGGCCGTCCTCGGACGGCTAGACAAGAAGGTCCCGGTAGCCAACGTGCTTCCGACAGACCGGAAG
ACGGAGCAGTACCAGCCTCAATTTGGTGAGTGGCTTGGCTTTCAGGACACCAGGTAGACGAGAGAGAGAGCGGAAGACGC
TGACCAAAAAAAAAAACAGTCCGCGCATCCAACATCACGTCAGGGGCGCTGGCTTTCATCAGTGACGGCGTTTGGGGCAA
GTTCGTCCCGGCTGCCCTGGCCAACGGGTCGCTGCAGGCCAAGCCGGACGCTCATGTGATCGGTCACGGCCTCGACAAGA
TTCAGCATGGCATCGATGTGCTGCGCAAGGGCGTCTCGGCACAGAAGGTGGTGGTGACACTGTAAGCACCAAGATTTACT
GGAGCAGTATCGTAACCGTAAACGCTGGAGATCGAGATAATTGTATTTGACTTCGATGCATGGATATTCCGTTCTTGTTT
GTGAGTAGAGAAAATGGTGTAATTCGCAGTGTTGGCATACGTCGATCGTACTTACAGCGCTTCTGCTGGGTTCCCCCACT
CGAGTCAGGTGACGAAGCCACTAATTGGCGTAACTCCGCCACCACCTCCAATTCCCTGTTTCAGCATCGAGCAGGCCAGA
GGTTCAGACAACCTGACAGCCGCGAAGCCGCGAAGCCACCAGTTCTTTACCTTCTCAGCACGCAATCTTCTCTACAATGG
CGCCCCACAACGGCCTCATGCACGGCACCGAGTACGACATTGAGGACAGCAATGTGGAGCTGATTGGCAGCGAGATAGAC
CACCGCGTCAAGTACGCGTCAGCCGCGACGGAGCCGGCCTGGAACGACGGCGTGGTGAGTCGGCAGCCCGGTCTGTTTGT
GTGGCGGGTCGAGGATTTCCAGCTGGTGGCGGTGCCGCCGGCCGACCGGGGCGTCTTTTACGACGGCGACAGCTATGTCG
TGCTGCACTCGTACCGTCTCGGGCCGGCCGACGAGAGCAGTGCCCAGGCGCCGCGGCTGGGCCACGAGATCTTTTTCTGG
CTGGGCGCCCACACGTCGCAGGACGAGGCCGGCACGGCCGCCTACAAGACGGTCGAGCTGGACGAGTTTCTGCGCGGCGC
CGCGACCCAGCACCGCGAGCTGCAGGCGAGCCCATCGGCCGCCTTTCTCGGGCTGTTTCCGCGGCAGCGACTGACGATCC
GACGAGGTGGCGTGGCCACCGGCTTCCGGCACGTGGATGTGGAGGGGGAACGCGACAAAGCGGTAGGGAGAGCGCCCACG
CTGCTGCGCGTGTTCCGACAGCCCGGCGTGGCAGCCGACGGCGGCGTCGTGGTGCACGAGGTCGAGGCGTCGTGGCACAG
CCTCGACGACGGCGACGTGTTCGTGCTCGACAGCCCGGCCGACGCGACCGTCTACGTCTGGCAGGGCCGCCGCTGCAGCC
CGATGGAAAAGGCGCGGGCCGCCGACGTGGCCCAGGACCTGCTGACGCCCGCACACGCCGGCAGCGTCCAGGTGTTGGCC
CAGGACGAAGGACGAGCCGGCCGTGTTGTCCGGCTGCTGGGGGGCGAAGACAGCCAACAGGGCCAGGCCTTCTCGTCTGC
ACGCCCCTGGGCTGCTGCGGCCCACGATCCACAGGACTCCAACGCTCCCGCCAGCTCGGCCTACCCGCAGCGCCTCTGGC
GGCTCAGCGACGCGTCCGGCTCTCTCGCCTTTGACCTCGTCCGCGAGACCACGGCGGGCACCTCCGTCGACGAGCTCGAC
GGCCAGGACGTCCTCCTCTGGGACGACGGCGGCCGTCAGATCTGGGTCTGGGAGGGCCGTGGTGCCAGCCCGGCTGAGCG
TGCTCATTGGCTCCGTGTGGCCCAGGCTTACGTGCGGCAGCTCGTCGGCGAGCGCGGCCGCCAGGCCGCCCAGACACCCA
TCGCCAAGGTCCGCCAGGGTTACGAGAGCCCGGCCTTTTTGCACTCGCTGCAGGCCTGTCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62