GenePrediction:GLEAN_6946 Details

Name: GLEAN_6946
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:733836..733085 (- strand)
Length: 752
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:733836..733788 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_108:733730..733400 (- strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_108:733346..733085 (- strand)
Length: 262
>GLEAN_6946 class=GenePrediction position=GCSC_108:733836..733085 (- strand)
ATGCAGTTCTCTACTCTCGCCCTCTCCGCCCTCCTGAGCACGGCCTCTGGTACGTCTCGCAGAGTATGAAAGTCTTGGGA
GTGAATGTCCCACTAACAATTCCCAGCCGTCAGCGTCACCGTTGTCAAGGTCGCCAATGTCAACAACGCGCTCATCTACA
GCCCCGACAGCATCACCGCCAAAGCTGGTGACATGGTCCAGTTCCAGTTCGAGGCAGGCAACCACACCGTGACCCAGTCC
ACCTTCGACCAGCCGTGCCAGCCGATCAGCGACTTCACCAAGACCGTGGGCTTCCACTCTGGCTTCATCCCGGTCACCGC
CGCCTCAGGCGTGATCCCCACCTACACCATCACCATCAACGACACCAAGCCCATCTGGGTGTACTGCGCCCAGGGCAAGC
ACTGTGAGGCTGGCATGGTCATGGTCATCAACCAGAAGTAAGCCCCCACCGCCCTCCATCGCCATTTATGTAATTTTGCT
AACTGTTCAGCACTACCGCCAACGCTACCCGCTCATTGGAAGGCTACAAGGCATTGGCTGCCAAGGCCAGCACCATCGTC
CCCGGCTCTGCCTCCAGCGGCACCAAGGGCACCACCACCAACAGCACATCGTCCTCCACGTCAAGCTCCAGCTCCACCGG
CTCTTCGAGCTCCAGCTCCAGCTCCGTGGTCACTACCAGCGGCGGCTCTGTGCTCTCTGTTCCCAGCATTGTCACCGGCA
TGGTGGCTGTCGCTAGCTACTTCCTGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62