GenePrediction:GLEAN_6947 Details

Name: GLEAN_6947
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:731263..728820 (- strand)
Length: 2444
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:731263..730907 (- strand)
Length: 357
Type: CDS
Source: GLEAN
Position: GCSC_108:730838..728820 (- strand)
Length: 2019
>GLEAN_6947 class=GenePrediction position=GCSC_108:731263..728820 (- strand)
ATGGATGTCGAATCCAGCCGTTCCGGCTCACCGACACCACTCCAGGTGGCGTCACCGGAACGCATCAACAAGCAGCGTGA
ATCGGCACTGTTCTCGGCGGACAGCAGCAGCCTTGGCTTCTCGTCCAGTACAGCGTCGGTCACGGACAAGATCAGCCAGT
TCAACTCGCTCGCATCACAGTCGAAGCAGCTGGAGCGCAAGACGGCCGATGCGGCACTCAAGCGGGCCATGCTGGGGCGG
GAGGAGGCGGAGGCGGAGATGCGACGGTGCCGCGATGAGGTGCGGCAGCTGCGGAAGCAGATGGAAGAGGGACGTGATCG
AGAGCGGCGCGTGGGCGAGCGGCTGGAGACAGTAATGGTAGGCGACCCCTCTCTGTGTGGCATCGGCTCACTTTGGGGGA
AAGGCATGCTCACTCTTGCGGACAGGAGAACTACGGCCGGTCCAAGGAGACACACGCACACACACAGGCGCTCTGGGAGA
AGGAGATCCGACGGGCACGCAAGGAGACGTTCAAGTCGCAGAGCACCGTGGTCAAGCTGCAGGAGGAGCTCAAGGCAGCA
CGGAGCAGCACCAAGGCAGCACAGGAAGCGCTAGAGCACGAAAAGCAACGAAGCAAGGCACGGGAACAGGAGGCGTTCCA
GGCGCGATACGAGCTGGTGGGGTGCCAGGAGCAGCTGCAACAAGCGCAGCAGATGGTCAAGACGCTGGAGCAGGAACGGG
ACGCGTTTAAGAGCCTGGCCAAGTCGGAGGAAGACATGGTGCGGATCGCGTCCGAGGGACGGCTGCCGCTGCCGCCGCCA
GATGAGCAAGAGAAAGAGGAGGAGGAAAAGGCCGAGGAGGAGGCCCAAGCAGAGACCAAAGAGGATGATATGGCCGACGA
CACGCCAGCACAGAGCGAGACCGAGCAGGTGTTGGCGCTGGCCAAGACGCGGAGAAAGAGCGGCAAGCCGTGCAAGTCGT
CTGCATCGCTGCTGGACATCCAGTCGTCTGCAGCGAGCGAGGCCGAGATCGACGAGCTGACGCGGCAATGGCAGTGGGAG
AAGCAGCGGGCAGACCGAGCGTCGGAGCTGGTAGAGTACCTGGAGGCGGAGTGCCACCTGCGGGCGTGCTCGTGTGCGCG
CAAGCGACCGCGGTCGAGCACGCTGGAGTCGGCACGGAAGCGACCAGCACTGGGCATTGAGGCGGACGTTGGCGAGCGCG
TGATCCTAGGCGACAAGGCAAGCATCATCACGTCGTCGACAGCACAGATCCGAGCGAACATGCAGCCGATAGCAAAGAAG
ATGCGACAGGAGGACAGCAGCCTGTATGCGCCCGAAGACGGCGTCTTTCGCACAGTCTCTCAACAGATGACGGAAGAGTC
ACAGGAGATGCAGGACCTGCAGGATGCGCATGAGGCGTCGGTGACGTCGGTGGCAACAACAGCCGTGGCTGCAAGCACAC
GATCGGAAGAGCAGCCAGAGACCAGTCTGCACAAGGCTGAGACTGTTGTCGTGGCCGAGATCGACACAGCGACGGGCAAC
GAGACAGCCGAAGAACCTTCCATGTACGCACGCTCACCCTCTGCGGAGCCTCCCTCGTTTGCCGTTCTTGCGAAGAAGCG
CACCTCTCTCCTCTCCCTGCTTGACGCACCGCATCGGAACGGTGGCGAGGCAACCCCGGGCTTCCACTTCCACGTGCCGA
CGACGTCGGTGGCACCGGACATTCCCGCTGACATGGTCGACACGGCAGATGTGGCAGATACGGCAGACACGGTCGAACCG
ACGAGGCAGCGGACGTCCGCCACGGCCCAGGCGTTCATGCGGCTGGCGAACGCCATCGACAGCGGTGAGAGGAGGTCGGC
ATCGTCTGTGGGAGCGGCTGATGAGTCGAGGTCCTTCTCGGCCACGTACACGACAGCACCCGAGATCCGGCACTCCGACG
TGCAAGACTATATGGAGCTGGACGTCGAGCCAGAGCAGCAGCAGCAGCCGGTGGCGGAAGAGGCCGGAGACGGGCCGTAT
GCGGTGAAGACGACGGTGACGAGGGTTCCGCTGCGCGAGGAGACGGCCGAACCCAGCCTGGCACAGCGACTAATGGCAGC
GCAGCGGACACCGACACAACGGTCGACATCGGACCACTCAGACGTCGGCAGCGAGAGCAGCTTTGACGTGACCACTCCGG
CGCTGACGCCGACGATGTCGCGTGAGGAGTGTCTGGCGCAGATTAGAGAGCGGCGCGGGCGAGCACGCAGCGTGGCAGGC
AGTCAGCGGACAGCAAGAAGCGGATCGGTGTCGAGTAGTGGCCGGCGGTCCGTTGCAGCGACAGCAGCTCCGGCCGCTTC
GACAGCGTCGGCAGCGTCGGCAGCTCCTCCGGTGGTCGCACCACGGCGGCCGGTGACGCCAGGCAGCGATCGACGAGACG
TCAGTGCACCTGTGCGGCGAACGGGCAGCGTGCGACGGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62