GenePrediction:GLEAN_6949 Details

Name: GLEAN_6949
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:713120..712124 (- strand)
Length: 997
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:713120..713079 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_108:713023..712995 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_108:712940..712124 (- strand)
Length: 817
>GLEAN_6949 class=GenePrediction position=GCSC_108:713120..712124 (- strand)
ATGGCCATCTCAAGTCTTTTGGCTCTCATCTTACCGCTGGTGGTATGTCCACACAATATACTCTGGTTATGCTGGTGCCT
GGCTGACAATGAGGCAGATCACCTTCGGAATTCTTGCTGTGGCCATGTGAGCCAACTTCCCTTGATTATTGTCATCCCAT
CGCTGACGTTTCTTGCACAGTTACGAGCATGTTGCTTCGTTGTCTTTGTCCCTCCCGATCGCACCCACGTTGACCGCTTT
TACGATCGCGTTGCCCGTTGCTGCTATTGCCAATGCAATCTACCTTATCCTCAGCCGCCAACGTCGATCTCAAACTAGCA
GAACGAAGAGCCTTCTATGGACGAGCGTGCAATATGGAAGCGTTCAGCTCCCTAGCCTGCCAGTCGTCTTGCAGTTCCTG
CAGGGCATCATCACAGTGGCCACAGCGGCGATACTCATAGTCAACAACATCGCTGGGGGGTCTCCGAGTTCTTCTTCGCC
ATCCCCCACCCTTCGATGTGCTCTTGAGACAACATGGCAGCAGCTGTACAGCGCACACGATGCCGCTGCTTTACGGCGGA
TCCAGGACGCGCTTAACTGCTGCGGCTTCAACAGTGTTGTCGACCGGGCATGGCCGTTTCCGCACGGAAGCGGAAGCACC
ACGTGTGCGCAATCGTATGGCCGCACGACTGCGTGCCGTGTGCCCTGGATGCAGACAGTGCAACGACGAGCAGGCGTGGA
TCTGGCGGTGGTCGTGGTCGTGGCGCTCTTTCAGGTTCTCACACTCGTCGTCAGAGAGTGGCCGGCCTCATCTTTCAGCT
ATCACCCGCACGGAAGCGGTGAGCAGCAAGGTGTGCGCAGGCCTCTTCTGGAGGATCGCGTTGCGGAGGCTTATACGGAT
GACGTGGATGACGTGGATGGCACCGATGAGGCCAGGGAAGATGCCAACAATCACCAGGACAGCAATGGCCCACGTCTGGA
GCCGTCGGGATTGCAGAACGCGTGGTCCACTGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62