GenePrediction:GLEAN_694 Details

Name: GLEAN_694
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1477595..1479891 (+ strand)
Length: 2297
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1477595..1478049 (+ strand)
Length: 455
Type: CDS
Source: GLEAN
Position: GCSC_97:1478111..1478692 (+ strand)
Length: 582
Type: CDS
Source: GLEAN
Position: GCSC_97:1478989..1479602 (+ strand)
Length: 614
Type: CDS
Source: GLEAN
Position: GCSC_97:1479668..1479891 (+ strand)
Length: 224
>GLEAN_694 class=GenePrediction position=GCSC_97:1477595..1479891 (+ strand)
ATGGCGTCAACGGTCATTGTTGGCGCCGGCATTGTCGGCATCACGACAGCCTACTTTCTCAGCGAGCACCAGCCGGCCGA
TACGATCCACCTGGTGGAATCATCGGCTTTTCTAGCCTCGGCCTCAGGCTATGCCGGTGGCTTTCTGGCGCGAGACTGGT
TCGACCCCAAGGTGTCGGAGCTAGCTGCGCTCTCGTTTGACCAGCACGACCGCCTGGCTGCACAGTACGACGGCCACAGC
CACTGGGGCTATGTGGCCTCGACGTCTCTGGACTACGAGTTGTCCCCAAGTGCTGCCGGGGCGCAAAGCAGAAACACCGG
TCCTGATCTGATGGGTCAAGTCACCGGTCGGCCAGACGAGGCTGCCAGCTTTACGGGAGGCTTCCCGGCCTGGATCTGCC
GTCGGGACGGCGACGCTGTCAAGCCGCGTGGCAGCAGTGGCACGACAGCCCAGGTGTCTGTTGCTTTACTACCCCTCCTC
TCTGCTGGTGAAGTAGCTGCTGACAAAGCGGTCCAGTGACCCGCTTGCATTTTCAAACTTCTTTCTGAACGTCTGTCGAG
AGCGCGGCGTGAATCTGCACCAGCCAGCCCGCGTCGTCACTGTGGGGACGAACGAGGACGGCGAGCTGGACAGCGTCGAC
CTCCAGTCGACAGGAGGAAGAGAGGGTGCGACTTTGACGACGACGCTGCCCTGCACGCGTCTCATCATCGCGGCTGGCGC
CTGGTCTGGTCGCGTCTTTGACGAGCTTTTTGGCGGCGGCGCTAGAAGTCCGTCTTGCGGCATCCCCACCAGCAGCGTTT
CTGGTCACTCGCTGCTGCTCCGGCCGTCTTCCCCTCCTTCTGTGGACGTGTACGCAGTCTTTGCCACGGGCGGCTCGCTT
GACTTCCACGCGGTCCTCTTCGGCCGTGCCGACGGCTCCGTCTACGTGGCCGGGCTGAACTCGACGGCCGATCCGGTTTC
GGCCCTCTCGACAGACTCGGTGCCGTTCCCCAATCGGCTAGACCACCTGCTACAATGCAGCAAGGCGATTTTGGGTGTGG
CTGCCGAGGACAACGTCCCCATTGTCCGCTCGGGACTGTGCCATCGCCCAGTGACGCCGTGAGACTTGCCGCTGGTGCTA
CGGCTGCCGGATGAGCATCTACACGGCAACACCGGAAAGAGCGTCCGGACGAAGCCGGGGACGGCCGCTCAGTGCGGATC
TGAGCGGGCTGGGCTTCCATGGACGAGGAGCAGGGGGCTGTTGTACTCCGTACCCGCAACAATGGCATATGCAAACAGAA
ATGAGCTCTAGCCCGAGACAGCATCAAGCCTTCTCGGGGCAGTGGGACGCCCCTCCTCACCCTTGCACTGCCTCCCATAT
CGGCCCTGACACATGCAGACATACGACGTAGTAGGGCAAAGTACGATGCGGACCCAGTGCGGCTGGCTAGTGGGGCAAGA
TCGCGGCCGGTCTTCTCGCAGCCCGGCTGCTTGGGGATCAGGCCGAGGCTGCAGATGTGGTGGTGCGCAGATGTGGTGTT
GAGCAAAAGGGTATCTGGGCCACCTGTGAACGGTTGCCTCTGTCGGACTTACCAACCGAAAGACAGACAGGACGAAAAGC
AAAAAAAAAAAAAACAAAAAAAAAAAAACAAGGCGACCGAGATCCACGCGGTCCTGACGCCATGCTGGCCACCGCAGCGG
TCGCAGCGGCCGTATCGACTGTTTGCAGGACGTCGAGAGGTCGTATCGCATCTGCAGCTGCAAGGTAAAAAGTACGGAGT
GCTCAAAGTGGGTACTCGATTCCACGTGACTCGACGTTGGAAGCCCACATGCCAGCCAATCACAGCGCACACATTGCCGC
CGGAATGCCCCCCTGTCGACAGGCCCCAGGGCAGGGAAGCTCAGACCCACCAGACGTCCGGCCAGTGGGCCAATGAGAAG
CCGGCTACAGGGGAGCGCACAGAGGGTCTGGCTACTGGTGTGGGTGCCTGCTCCGATATTCTGCCTTTCATCGTCCCGCG
CACCTCTCGTCATCGACCGCTCCGGGCCAATCCCTGTTCCGTCGCCGCTTTTTTCTACTCTGGCTCTGCACAGGCCGGGA
AGAGGGTGTGCACGCAGGTACTCTGTACAGGGGATGCACAGCAACTGCCCTCCGAGGCTTGGCTCTCTCTTCTGCCGTCT
TCCAGGATGTCTCACAAGGTGCAGAAACGGCTCGATACAACGCAAGCGATGCATTCGAGTGCGTTCACACAACAAACATG
CATCTCATCACTGCAGACAGAGTCACGCTTGCTGCCAATTTGCCTATCGCGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62