GenePrediction:GLEAN_6950 Details

Name: GLEAN_6950
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:707676..705729 (- strand)
Length: 1948
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:707676..707521 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_108:707450..707418 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_108:707359..707304 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_108:707230..707203 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_108:707141..706521 (- strand)
Length: 621
Type: CDS
Source: GLEAN
Position: GCSC_108:706467..705859 (- strand)
Length: 609
Type: CDS
Source: GLEAN
Position: GCSC_108:705782..705729 (- strand)
Length: 54
>GLEAN_6950 class=GenePrediction position=GCSC_108:707676..705729 (- strand)
ATGGGTCACCTCACCGAGATCAAGCACAGAGATGCTACCACTGAGAAGGATCTCGTCAGCGAAGTGAAGAAGGCGCACCT
GCAACTTGCCAATGACGATGACTGTTTTACCACGTCCGTTTATGGTTCCAGATTTGCCATGATCGAACTGCCTCGAGTGC
GTCACCCTTCCTCTCCTCCATTTACGTCCGGATTTTCGATAGTCTGGGGTTTCTAACAAGCAGCAGCACGAACTTGCAGA
GACTGAGATGCCTAAGGAGGTAAGTTCCCCCGTAGCTGGACTCAAGTCTACAGAGTACTCACGAATTCCCTACATAGGTC
GCGTATCGCATGATCAAAGATGATCTCAGCCTGGACGGTAACCCCATGCTCAAGTAAGCCGTTCTTCTTATGGCAACAGC
CTCCAATTACTTTTCAATAGCTAACAATATTTTTTTATTTTTTTAGCCTGGCGTCTTTCGTCACCACGTACATGGTTCGT
CAACTCTGATTGACAGTCAAGACGGGTGTTACTTATACTGACGTTACTTGTGTAGGAGGACGAAGCCGAGAAGCTTATGA
CTGAGTCCTTTTCCAAGAACTTTATCGACTATGAGGAGTACCCCCAGTCCGCGGATATCCAGAACCGCTGCGTCTCTATG
ATCGGTCGCCTCTTCAATGCGCCTGTCGGAAGCACCACCGAGGGAGGTTCTATCGGCACTTCTACGGTTGGAAGCTCCGA
GGCAATTATGCTGGGTGTTCTGGCCATGAAGCGGCGCTGGAAGAACAAGCGCATTGCCGAGGGCAAGTCTTACGAGAAGC
CAAACCTCGTCATGTCGTCTGCCGTGCAGGTGTGCTGGGAGAAGGCCACCCGCTACTTTGAAATTGACGAGAAGCTCGTC
TACTGCTCAGAGGATCGCTATGTGATTGACCCAGTGCAGGTCGTTGACCTGGTCGACGAGAACACCATCGGAATCTGCTG
CATTCTCGGCACTACCTACACAGGCGAATACGAGGATGTGAAGGCAGTCAATGACCTGTTGATCGAGCGCGGTTTGGACA
CTCCCATCCATGTCGATGCTGCTAGCGGCGGCTTCGTTGCTCCCTTTGTTGTCCCCGGCCTCGAATGGGACTTCCGGCTG
GAGCGCGTCGTTTCCATCAACGTCTCGGGCCACAAGGTGCGTTTAAGCATGATACCGAGCACCATCTTTCACCCTAACAC
GCCTTTTAGTACGGACTTGTGTACCCTGGTGTCGGTTGGGTTGTGTGGCGTTCCGCCGAGTACCTCCCTCAGGAGCTGGT
GTTCAACATCAACTATCTTGGCGCCGACCAGGCTTCGTTCACGCTCAACTTCAGCAAGGGTGCTTCGCAGGTTATCGGGC
AATACTACCAGTTCATCCGGCTGGGCAAGCACGGATACCGTGCTATTATGTCCAATCTGACACGCACTGCCGACTACCTC
TCAGACTCGCTCCAGGCCCTCGGTTTCGTGATCATGTCCAAGAAGTCGGGTGAAGGGCTGCCTCTCGTTGCCTTCCGTCT
TTCGCCCAGCAAAACCCGAGAATACGACGAGTTTGCTCTCGCCCACCAGCTGCGCGTTCGCGGCTGGGTGGTGCCTGCTT
ACACCATGGCTCCCCACACGAATGGCTTGAAGATGCTCCGTGTTGTCGTCCGCGAAGACTTCACCTGGAACCGATGTGAC
TCGCTGATTGCTGACGTCAAGCTGAGCATGACGTATCTGGACGAGATGGACAAAGCGACGCTCCGCAAGATCGACGAATT
TGTCCAAAAGCACCACACGGCTGGTAGCCACTCCGTGCACAACCATCCAAAGTTCCGCGTTGGTCCCCTTCCTAATATGC
CTGTGGCTTTATTTGCGAGAAGCGTTATGCTGACCGGCCGTCTCTGGCCTATAGAAAGAAAAGCACTCGCTCCAAGGGAA
GACGGGCAAAACCCATGCTGTCTGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62