GenePrediction:GLEAN_6951 Details

Name: GLEAN_6951
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:704999..702443 (- strand)
Length: 2557
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:704999..704908 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_108:704840..702443 (- strand)
Length: 2398
>GLEAN_6951 class=GenePrediction position=GCSC_108:704999..702443 (- strand)
ATGCTTGATCACGTTCTGGGTCGACCGTCGGTCAAGTCGCGCCGGCTCCAAGTACTGGCCGTGCTGGTTTTTTGGCTGAC
ATATCTCGCGCGGTAAGTGTGCTGCGTCTTGCGATGTGTATGTGCTGTTCTCGCGGTCTGCTGATTCCAACCGTGGCAGT
GGCAACAAGAATGGCCCTCTGGGCACACGAACACTCTCCCGGCTCCTCTCGAAGAAGTTGACGGCCTGGCAAATGGTCGT
GCTCACGATGACGTACCTTTACACGGCCCGCAACTTCAGCACTCTTGTTGGCCTCGCGAGCCCCGACCCTTTGTCAAACA
TGTACGATGCGACCTTTTTCCGCGCGACGTGGGTCTTGACAGCGCTGGACGCCGGTTTCTGGACGGCGATGAAGATACGC
TCCCGCTGGCTGCGTGATATTGCCGGAATTGTCTTCTCGGGCTTCTACCTCGTGGCAGCCGAGCAGGCCGACGAAAAGGT
GCGCAAGGTGCGCGGCAACCTGACGGTGGAGCACCTTCGTGTCAGCTGGAACAAGGGAACAACACCGTACCTGAACTTTA
TCCAGGGCCTCACGCGGCCTCGGCTGACGCGCTGGCCACCACGATACATCCGCATTCCCCGGCCGGCGACAAGCGACTAC
AAGGATCAGCCGGTGATGGCCTGGCTCTACTACGACGGGTCGATCGACCACCTGCGGGCATCTGGTATAAACCGTGTCAT
CCTCGACATTCCTGGCGGGGGCTTTGTTGCCATGGATCCGCGCTGCAACGACGACCGACTCTTCACCTGGGCCGTCCATA
CGGGGCTTCCGGTCTTGAGTCTGGATTACAGAAAAGCACCGGAGCACCCGTTTCCTTATGCGCTGTACGAGTGCTATGAT
GTATATTCGACGCTGGTCAACACGCGTGGTCGTTGCATTGGAATGGCTGGCAAGGAACCTGCGCATATCGTAATGTCGGG
CGACAGTGCTGGGGGCAATTTGGCGACGGCGACGACGCTGATGATAGCGCAATCTGCGCCGACACTCCTGTCGATGCATG
AAAGAAAGGATGCAGGCAATGGACAGGAGCAGGAGCAGGACCAACAACAGCTTCCGCTTCCCGAGGGATTGATCTTGACG
TATCCGGCCCTGGACATGAACATTGGCAGCTGGATGTCGGACGAGCAGATGGCCCTTATCCAGGACAGACGCATGCGGGC
GACGAACAAGAATGTGATCCGCCGCAAGACCAGCCAATACAACGACATCGCAGGGACACCGCACGAGTCTGGCGACGAAG
CATTAGTCATGACGAGCATGGCGAGGGCGGAGGCCGACGGTAGCGACGGCGATGACGATGACAGTTCGGAGGATGATGAG
GAGAAAGCACAGTCTCAGGGAGAAGATGCGCGGAGACCCAAGCCGGCGTATTCACATGTCAACATGGCGAAGTTTGGAAA
GACATTGCAGGCGCGGCCACGCACACCCCGAGGTGACGCCTCATCGACCTCTGGAGGGGTGCAGCCGATCACACCGATGG
AGTCGACACTGTTGGTGGCAGGACCGGTGCCAGCGCCGGCTTTGCAGACGCGGCTGACGACGTCGTCGACGATCTCGTAC
TTCAACGACCGGGTGCTGACGCCGGAGATGATGCGGGCAATGATCATTCTGTACGTGGGACCACACAGCCGGCCAGACTT
TGCGCGAGACTACCTGCTGTCGCCGATCCTGGCGCCAGACCTGCTGCTGGCGCGGTTTCCCAAGACATACTTTCTGACGG
GCGAGCGCGATCCGTTGGTGGACGACACGGTGATCTTTGCGGGACGACTACGGCGGATCCAGGCGGCGCTCTGTGCGTCA
GGCGGACGGCGGCTCGAGTACCGCGAGTCGGACGCAGACGTGCTGGCCAAGATGGGCTTTGACGATCGCGACGTGGCTGA
GGTTGTGCTGGTGCCCGGTGTGAGCCACGGATTTCTGCAATTTCCGGCCATCTACCCGCCAGCCAGAGGATGGTTTGAGC
GGACAGCTCACTGGATCGAGGACGTGTTTAAGCACGCAGAGACAAGACGGGCCAGCTCGGGTCTGTCGGCAGTCCGTGGA
CGCGGACGCGGACGTGGCCGCGTCCATGCGGAAAGGGGAGACAAGGCAGGAAAGGTAGAAAAGGCAGGACAGACAGGGCA
GGTGGAAACGGTGCAGACAGTTCCGAACGTCACAGGTGGAAACGGCAGCGGCACGCACGCAAAGACAGAGTCGAGCGGAG
ACGACGAGGGCCCGCTCGAGATGATGCGCATGACCAAGGCCAAGGGACCGGCCAAGACGGACAACAGCAATGGCGGAGGA
TCACCAGCTCCGGAAGAGGAGCAGCCGTTCCGGGAGAGTTCGACGACGTTGGTGGAGGGGACGAATGCCGGTAGCGCTTC
GACAAAGAAGAAGCGAGGGAAAACGGCGAGACCACGAGGAGGCAGCAGCAGCAGCAACGGCGACAGAGAGCTGGTGAAGC
TGGCCAGCTCAGACGATCTGTTGGGACGACGGATGCAGGGCATTGTGGGGGGACTGACGGGGGTCACAGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62