GenePrediction:GLEAN_6952 Details

Name: GLEAN_6952
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:691895..688686 (- strand)
Length: 3210
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:691895..688686 (- strand)
Length: 3210
>GLEAN_6952 class=GenePrediction position=GCSC_108:691895..688686 (- strand)
ATGGCGGCCGCGTTGCACAACTCGCATCTTCACTCTCCCAACCCGTCCACAAGATCCTACGACTCGTCATCTACGTCATC
TGCGACGTCACCCAGACTCCTTGCACTGGTATACAGCCAGCAGCAACAACAACAGAGCACGAGCACAGGTGCGAGGCTGA
CTGCAGTGACCCCGGGTCCACAGACATCGACCGGCAGCATGCTGCCCACGCCGTCGCCGTCGATGCAGTTAGGCCTGAGG
GAGGACCAGGGCCATCATAGCCACCAGGCCTACCCACAGCAGTCACCGTACCCGGCCTACGCCCACATGGCAGGCACGTC
ATCTCAGCCGCCACCACCGCATCCATACCACCACGCCATCCAGCCCTACACGGCCGGCGGGTCGACCATGCCATCAGGCA
GCGAGTCGGCCGTTAGCACGCCAAACCCCGGGTACATGCCATTGCCGCCCAGTAGCGGAGGAGGAGTAGGAGTAGGAGGT
GGTGGTGGTAGTAGCAGTGGTAGCCTAGCAGGAGGAATGGCCATGTCACCGTCGATGTCGCCTGCGTATCAGCAGCACCA
CCACCACACACAGAGTCAAGTCAAGCGGGCATACCGGCAGCGACGCAAAGACCCGAGCTGCGATGCATGCCGCGAGCGCA
AGGTAAAATGTGATGCGACGGAGACCACGAGCTGCTCCGAATGCGCCAACAGACAGGTCAAGTGCCAGTTCACCAAGGAG
ACGAACCGACGGATGTCGTCGATGAAGCAGATGCAGGACCTGGAGCGGCAGATGGACCGGATGCGGCGGGAGAACAGCGA
GCTGCGGCGTCTGCTGCACGACGGGGGATCGGCGGTGATGAGGGCTGAGAGCATGTCGGTGAAGCCGGAGCAGCAGAGCG
GAGGGTTGGCGGATCGACAGTGCTCAGGGCCCAGCAGCACCGGGCTGCAGCTGCCGACGATCGGATCGAGCCCACGGCGA
CGACGACGACAACAGCAACAGCAACAGGCGAGCCTCAGCCATGGAGGCCACCACGCTGGAAGCGGCTCGGAGATGCCTCT
GTCAATGGCTGTGGATCTCGGCCGGGTGAGACACAAGCTACAGATGTTTGCCAAGGGCATCTGGCAGCCACCAGCTCTGT
TTCTGGCGACGACGACGACGACGACGGCGACGACGACGACGACAACAGCAACAGCGATGCCCTTTCCACACTCTAACCTT
CCCCCGCGACCGACAGCCGAGCCTCTGCTGCGGGCTTACTATGACTTTGTGCAGCCGATGTTGCCGATCCTGCACTGGCC
AACATTCGTGCAGGATGTCGAAGGGCTTTACCACTGCGATCCGCGGTCACCATCGTCATATCCGCCGCCGTCGCCAGCCT
TTCTGGCGGTCCTCTTCGCTGTGCTGGCAGTCGGGTGTCTCTTCTGCGCGCGGCCGCACCCCGACGCGGGCTTTGGCGCA
GCCGATCTGGCCGAGGCAGCACGCGAGCTGCTGGACCCCTGGGGCGGCTGCACGGCGGTGCCAACGCTGGACGATGCTCG
TGCACGCCTGCTGCTGGCCGTCTTTCTCAACGAGAGCCACCTCAAGTCGGCGGCGTGGACGTGGCTCGGCAGTGCTGTTC
GCGTGGGCCAGGACCTGGTTTTGCATCTGGAGGGCAGCGAGGACGGCCAAACACAGGCGCAGGAGCAGCTGCAGCTGGCT
GCTGAGATACGCCGTCGTATCTGGTGGTCCATGTACATTCTGGACCGCAGCCTGGCGATCGAGCTGGGCCGACCGCCGCT
GATCGACGACGACGACTGTGACGTGGCACTGCCGACGGCCGTGGATGAGCAGCTCCCGATGTTGGCGGTGCTGCACGTTG
TGCGGGCTTATACGGCCTTGGGACGGATGCTGCGAGCGGCTCCAGCGGCCGATTCGGAGAGCCAGGACAGCCGGGACGGA
CGGGACACGCGCTTCTTTTCACCGCACGACGACCGGCCAGCCTCGTCCTCATCCATGGCGTCGACACCCTCTTCGCCGAC
GTCTCCTTACGCCGCGTCGTCGTCGTTCTCGGTGCCATTTTTTGGCATTTCGGCTGCCGACTTGGCCGTCTTCGAGCAGC
ACTTTGCCGCCTGTCTGCAAACGTTTCCGCGACCAGACTGTCGTGGCAACAGCGACGAGCCCCCCCTCTACCTCGCGACC
CTGGCACCGGTGGCTTACGTGCTACATGCACAGCTGCTGCTGCACCGTGCCAACCTGATGCCGGCCTGCGCACAGTCTGT
CCGCCGAGCCGCCGTGGAGCGGTGCACGCGAGTCGCCCTCGAGACGGCCTCTCTGGTGGGCAGTCAGGTTGAGGGCGGTC
GAAAGGGCGCGACAGAAGCCGGACCGTGCACCAACCTGCTCGTGGCCCACCTCTTCCGCTGTGCCCTCTTTGCCATGCTC
GCCGGCCACAACGACACTGCCAGTCTGCTGGTTCGAGCGCTGGCCACTGCTGCCACGGCGCCTGCTGGCACCTGCCGCGA
CAGCCTGGCGACGCCCTGCGGTCGTTTTCTCAACTTCTTTGCGTCGTGCGTAGCTTTCAAGCGTGCCGAGTATGGGGCGC
GACCATTTGGAAATGCAGGCGGCAGTAACCCGGCCCATCTGCTCCTCCTGGACGAGGAACTGCTGGTGTATGCGAGCGCC
GACCTGCAGGCGACACCTGAGGGCGCCTGGGTCTGGCAGGGCGAGACGGCCGGCACAACTGCTGCCTCGGCCACGACGAC
GACGACGACGTACACTCCCCTGCACGTCAGCATGCGTGGTGGCCTCTCCGAGGACGAGAGGCGTGACTGGGGCGGCTGGG
ACATCCTGGAGGGCCGGCTGCGGACTCTGGCAACACAGCCACTATACAAGCCACAGCAGCACCAGCCGCAACACCAACAA
CAGCAACAACAACAGCCATACCATCAGCCACGACACCAGCCACGACACCAGCCACGACACCAGCCACTGCCATCGCCATC
CTCGCTGTCGACACTGACGGCCTACTCCAGCCCGCCCTATCACTACACCACCCAGACACAGGTGCCGCCGCGACCGTACG
GTGGCGCGGGCCCGGTCAAGACAGAGCCACAGGACGAGAGTCCACGAGCGGTGATGCTGCGTGGCGTCGGCAGCTTAGAG
CCATCCGCCGTGGCCTTGGCCCCAGCTCCGGTCCCGGTCACCGGGAAGACAGCCAGCCAGGAACGCATCAGCATCGCTAA
CATCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62