GenePrediction:GLEAN_6955 Details

Name: GLEAN_6955
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:656349..652803 (- strand)
Length: 3547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:656349..655992 (- strand)
Length: 358
Type: CDS
Source: GLEAN
Position: GCSC_108:655930..654830 (- strand)
Length: 1101
Type: CDS
Source: GLEAN
Position: GCSC_108:654568..653936 (- strand)
Length: 633
Type: CDS
Source: GLEAN
Position: GCSC_108:653395..653274 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_108:653102..652803 (- strand)
Length: 300
>GLEAN_6955 class=GenePrediction position=GCSC_108:656349..652803 (- strand)
ATGCCCACCACCACCATGGCGCCCATCTCTGTCACCGCAGTTCCCCCTCCCACCATCCCGACCAAGATCAAGCGCCCCAT
TCCTTCGGGCATACAGACCAATGGAATTAACTCCATGCGGTCATCTCCCTCGCCATCCATATCGTCTAAAAAGCCGCCGG
CAACGGCCAAATCGGTCATGACCGGCCCAACAGCCATCACAGTCACGCCAGTCCGGCCACCAACCCGGCCGGTGCGCCGC
GAGAACTCCATCTCCCAGGGTGGCGCTACTCGCAATGCGAAGGCCGTCGCCGGCATGCGCGCCGGTAGCATTGCCGTGGA
CACGTCTATAGCCCTGGTCGTTGAGCCTCGTCCCTATGGTAAGATTCATTTTGCTGCATCTGCTCTCTGGTGCATCTGCC
GTGTTGACCATCACGTTAGTCGTCACCGATGTGTACATCCTGAAGAAGTACAGCGGAAACCCACCCTCACTCGTGGTGCA
CATGCACGCGACACACTTTCGCTTCGACCAGCAGGACGGCATCTTTCCGTACAAGTCGCCCATGCGCGTATTTCTCGAAC
ACCTGAAAGCACGCACTGTCCCACATGACCTGGTCGAATACTTTATACAAGGCGGTGTTCCTTTTTATGAGGGCTGCCTG
ATAGTCCAGGTGTACGACCACAAGGCTGCAGTGCAGTCGAAGGATACAGTCCGCACTACAGCCACACCAACCAACGACAC
CGCTCCGTTTTCCATTCATAAATTCAGTCCGTATCTTACACCATCACCATATGCTCCTTTCCCGAAAGAGAACGTCACAC
CAGATGCCAAAGGCGGTCCGGCGGGCGCGGCTGACAAGAAGCCCAAGGAAAAGGCGCAGCAAGAAACGACTGACATAAAT
AACGCAGCTGCAGCGAACGGGGCATTGGAGGACCAAAAGAACAAGGTGCCAGCGAGGCCCCGGATCTTCACGGTTGTCCT
GCATCCGACAGCGCAAAGTCTGCATGCAGACATGGCCTTGAAAGCAGTCACGCCTCGTGGTGCAGAGACGCGGCGCGATG
CAAATGGCATGACATACATCCCACCACCCACTCCGATGACTGCAGTACCACCGACCCCCGGCGGTCCGGCATCAAAACGG
CAGAAGCGGGAACGGATGGAGCTCGACGGCAGCAACATTCCAGAATTTGAGGCCAGGGTGATCTTCTCGACGTCGGCCGA
GCTTGATTTGGAGCCGGCAAAGAGCGTGGAGGACGTGATTCGGAAGCTCGATGCCCAGGCACATCCCGATCACTCCCATC
TGCCACCGCAGCCGAAGACGAGGAAGCGGACGGTGGCCGAAATGGCGGCCGACGAAGCTTTGGCTGCCGGCCTGGAACGG
TACATGCTCACTCTCGACGAGCGTATCCACCCAAGCGGATCGAGTGGCCAAGGTGTTGCAAACGGCGCCGACGGCGATGT
CCAAGGCGGTGCTGCTGCTTTTGAGCCCCGCTTCGAGCGTTTCAAGCTTATCGAGGAGATCAAGCGCGAGCACAAAGAGC
GTAAGGAGCAGGAGAAAATCAAGCAGGTTGAGCGGGAACGCCATCTTGCACAGCAAAAGGCCGAACAGCAGGCTGCGGCA
CAGCAAGCGGCAGCCCTCCGCGACCAGCAGCTTCGGGAGCAACGTGAACAGGAGCGGATCAAGCAACAGCAGCTACTCCA
GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCTGTTGCAACAGCAACAGGCTCAACAGGCAGCACGCGAGCAGGCTGCGC
GCGAGCAGGCCAAGCAGGAAGCCCAGCGGCGTACCATGGCCATCCAGCAAGCACAGGCAAGAGCACATGCGGCACAGCTG
CAGCAGGCTCAGGCTCACCAGGCGCAAGCCATGCAAGGCCGACCCCAGACACCGAGTCAGCAAGCCGCCGCCCAGGCTCA
GGCTCAGGCTCAGGCTCAGGCACAGGCACAGGCTCAGGCTCATGCGCAAAAGGCAGCAGCTGCGGCGATGGGTCAGGCTC
ATGCAGGCATGGCGAACGGCTTCACCGGAATGCCCAACGGCATGACGTCGCAGCAGGCGGCCCAGATGCAAACCCGACTG
CAAGCGGCCCAGCAACAACAGCCGACAGCGTCGCCAGGCGGCCGACAGAACACGCCGCAGACCATGTCCTCGCCGATGGT
GGGACCGGTGGCAATGCAGGCGTCGACGTCCAGCATGGCCGGCAGTCCACCACGGCCGCCGTCGGTGGCACAGACACATG
GTCCGATGGCTGCACCAATGTCGGTCACCATGTCTGCCCGCGGCAGCCAGCAGAGCCACACGGCAGGGACGCCGCGGATT
CCCCATTCGACGCCGAATATGCAGCAGCAGGTGGCGACGCCTATCAGCCGGCCCCAGCAGCTTGCGCAGACGCCGCGGAT
GGCGACCCAGGGCAGTCCACAGCCGGGAATGCTGACGCCGCAGCAGCAGCAGTTCATGATACAGCAGGGCATGGCGAACG
TTGGGATGGGCACACAGCAGATGGGCAACGTGCCGACGGCAGCGCAGATTGCGGCGGCGCAGCAGCAGCAGCATCGTCTG
CAGGCGCAGCGGATGCATGCGATGATGCAGAACAACCCGCAAGCACAGCAGCAGCTGGCACAGCAGCAGCGGTTGCTGCA
GATGCAGATGCGTAACGCCGCAGCACAGCAGAATCCGCATGCGATGATGCAGATGCAGATGCAGCAGCAGCAGCAACAAC
AGCAGCAACAAAACCACATGCAGCAGTTGCAGCAGCAGCAGCAACAACAGCAACAGCAGCAGCAGATTCTGCAGCGGCAG
ATGATGAACGGGCAGAACCTGATGGCGGCGGCTAACAGCATGAACCTCTCGCCGGCCCAAATCAGCCAGATGCAGCACCT
GCAACAGCAGCGGAATACGCAGCAGCAGCAGCAGCAAGGCGCCGCACTGATGCAGCAGGTTCAAGCGCATAGAGCCAGAC
TTTATGGCCAGAATATTGGCGGAGTGGCGGCACGGTATGGCGGGAACGAAAAGAACATCCCGCCCGAGGAACTCGACCGC
TTTAATAAGATGTGCCTGGCTCAGGCGCAGCAGATGGTCAGTCAGACGCTCCAAAACTTGCAACAACGGCGACAACAGGC
TTTGCTGCAGCAGCAGCAGCAACAACAACAGCAGCAGCAGCAACAACAGCAGCAGCAGCAGCAACAACAACAGCAGCAGC
AGCAACAACAACAGCAGCAGCAGCACATCAACCAAGGCATGATGCAGCAAAACATGCCGCAGGGCATGCCGCAGGGCATG
ACGCAGGTCATACCACAGGGCATGCCACAGGGTATTCCTCACAGCATGGCCCAGGGCCTGCAGCAGGGGATGGCACAGGT
TATGCCGCAAGGCATGCATCAAGGCATGGTGCAGGGCCTGTCGCAGGGGATGCAGCAGGGGATGCAGCAAGCCATGGTGC
AGGGCATGAATCCGGGCATGAATCCGGGTATGAACCAGGGCATGGCCCAGGGCATGGCTCAGGGTATGGGCGGCCTGGGC
GGCATGATGCCACAAGGCCTGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62