GenePrediction:GLEAN_6956 Details

Name: GLEAN_6956
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:646755..645531 (- strand)
Length: 1225
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:646755..646485 (- strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_108:646396..645808 (- strand)
Length: 589
Type: CDS
Source: GLEAN
Position: GCSC_108:645726..645531 (- strand)
Length: 196
>GLEAN_6956 class=GenePrediction position=GCSC_108:646755..645531 (- strand)
ATGAAGTGGACAATCTCAGCATCGTCGGCCTCGCTGGTCCTCCTGGGCGCCCTGACGGCTCAGCCGGCCGCGGCTATGCT
GCAGTGCGGCCACATCCAGGCAGACGGCCAGAGGTTCGACCTGAGCGCTCTCAAGGGGCCGCACTCGGTCCTCACCACGC
AGCACACGCCCCCGACCGACCAGAACACGACATACACGATAGACCTCTGCGGGCCGCTCAAGCGGAAGGGCGACGTGCCC
AAGGGGGAGGAGTGTCCAAACGGCAGTTGGGGTGAGTTTTTTTGGTCTTTCATGCCCCATCTGCCCATCTGCCCATCCTC
CCATCGCTTCGTGCACCCGCTGATCACATCGGACACCAGCCTGCGCAATACGACGGTTTCGCAACGCCGAAGGCGTCACC
GGCATCGGCCAGGTCATACCGCTCGCCGGAAACCTCGAGGACCAGGGCGGCAGCGCGCTCAGTCACACGGCGACGCGGCT
CAAGACGGCCGACTCCAACGCGGACGCCCAGCGCGAGGGCCTCCGTCTAGTCCTGCAGGGTGGCCGTTACCCGCTGGACG
GTCCCGTCAGCGACCGCCAGAACCAGCGCGTCATCGTCGAGCTGCTCTGCGACAAAACCCGCGAAGGCACCGAAGGCGAG
TGGATCGCCGACGAATACGAGCGCGACGGCACCGCTCCTGGCTCCAGCGCCCCCCCAGCTGACCCGCCCTCCAACTCCAC
CACATCTGCTGCCGGCCTCGGCTTCTCGCTCGCCCAGGAGGGCCCCGCTGAGAAGCAGCTGCTGCGCGACGGCGAAGCTG
AGCCGGCTCTCGTCTTCCAGGGCTACGACGTCCACGACACCGACGGCTCCTTTGGCACGCTCCGCCTGGCCTGGCACACC
CGCTATGCCTGCGAGGGTGCTGCCCGCGTCCGCGAGCACTGGGGCTTCTTCACCTGGTTTGTCATCTTGTACGTTGCTTA
TGTAATCCTATTTTCCCCTATTTTCTTTCGGGACTCGTCTCCATAGACTGACCGTGATCGTCTGCAAAGGGTCTTCCTGG
CCACCGCAGCCTACCTCATCTTCGGGTCGTGGCTCAACTACAACCGCTACGGCGCCCGCGGCTGGGACCTGTTGCCGCAC
GGCGACACCCTACGCGACGTGCCCTATCTGCTGAGGGACTGGGTCCGGCGGCTGATCAACACGCTGCAAGGCAGCGGCAG
CCGTGGCGGATACAGCGCCGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62