GenePrediction:GLEAN_6958 Details

Name: GLEAN_6958
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:628974..627302 (- strand)
Length: 1673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:628974..628561 (- strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_108:628356..628011 (- strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_108:627942..627302 (- strand)
Length: 641
>GLEAN_6958 class=GenePrediction position=GCSC_108:628974..627302 (- strand)
ATGGCGGAGACGACGACGACGACGACGCGGACGACGACGCGAACGACAGCGGAGAAGCCGCGGACGGTGGTGTTTCTGCA
CCCGGACCTGGGGATCGGCGGAGCGGAGCGGCTGGTGGTGGACGCGGCAGTGGGCCTGCAGAAGCGTGGACACCGGGTGG
TGATCTTTACGAGCCACTGCGACCCGGCACACTGCTTTGACGAGGTGCGTCCGGGCAGCGGGACGCTGGACGTGCGCGTG
CGCGGGGGCAGCGTGGTGCCGCCGACGGTGCTGGGCCGGCTGGCGATTGTGTGCGCGATCGCGCGACAGACACATCTGCT
GGTGCAGATCTGGGCGTCGGGCGAGCTGGCAGCATTGCGGCCGACGGCCCTGTTTGTGGACCAGCTCTCAGCCGGGCTTC
CACTACTGCGATGGGTGAGCAGTCGATGTGGAAGCGAGCGAAGCGAGGAGAAAGAAAGCGAGCGAAGCGAGAAAAAGAAA
GAAAGCGAGCGAAGCGAGAAAAAGAAAGAAAGCGAGCGAAGCGAGGAAAAAAAAGAAAGCGAGCGAAGCGAGGAAAACAA
GAAAAAGATTCTTTTTTACTGTCACTTTCCGGACCTGCTCCTGGTGCAAGGCCGGCAGCGCTGGTGGAAACGGCTCTACC
GCATGCCCTTTGACGCTCTGGAGCAGTGGAGCATGGGGTTTGCGGACGCGGTGGCGGTCAACTCGCGGTTCACGCGCGGC
GTCGTGGCTGAGACGTGGCCGCAGCTGGCAGCTCATACGGACCTGCAGGTGGTGTATCCGTGCATCGAGGTGGGGGAGGA
CAAGGAAGAAAGGGACAAGGACGAGCCGGTGCTGCCGTGGGGCGGCATGCCGTTTCTGCTCAGCATCAACCGGTTCGAAC
GCAAAAAGGACGTCGGGCTGGCCGTGCGGGCTTTTGCCGGGCTGCCGGCCGGACGACGAGCAGGCAGCCGTCTGGTAGTA
GCAGGTGAGTTTTTGTTCTTCTGTTCTTCATTTCAACCTCCTATCTTCTTCTCCCCGCTAATTCGAATTCAGGCGGCTAT
GATCCTCGCGTGGCCGAGAACGTCGAGTACCACCGCGAGCTCGACCGGCTAGCGACTGACTTGGGCCTGCGCACAGCCAC
GGCCAAGACCATGGTCTCGGCCTTGGGCGTGCCAGCCGACGTCGACGTTCTCTTCCTGCTGTCGGTCCCGTCCGCGCTCA
AGACGGTGCTGCTGCAGGCCGCCCGTCTGCTTGTCTACACGCCGGCCCGCGAGCACTTTGGCATCGTCCCACTCGAGGCC
ATGCTGGCCGGCCTGCCCGTCTTGGCCTGCGATACCGGCGGCCCGACCGAAACGGTCGTCGAGGACGAGACCGGCTGGTT
GCGGCCGCCCGCCGACGTGGCCGCCTGGACTACCATCATGAGCAGAGCCCTGCCGGGGGCGGTCGACAGCATCCCGGATC
CCCAGCGCGCCCGCATGGCTGCTGCCGGCCGCCGTCGTGTCCGCTCCCAGTTTGCCGGCGCCCAGATGGCTGCGCGGATC
GATGGCATCTACGACGAGCTGGACGCGGCGGCTGGCAGTGGCACCAAGAAGAACCACCGCCCACCACTGCCGACAGGCTT
GCTGGTCGTGCTGGCTGGACTGCTGGGCCTGGTCATCGCCCTGGCCGTCGGCCTGGTCCGGTGGGCTGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62