GenePrediction:GLEAN_6959 Details

Name: GLEAN_6959
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:624723..622869 (- strand)
Length: 1855
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:624723..624133 (- strand)
Length: 591
Type: CDS
Source: GLEAN
Position: GCSC_108:624065..623641 (- strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_108:623585..623363 (- strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_108:623294..623157 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_108:623105..622869 (- strand)
Length: 237
>GLEAN_6959 class=GenePrediction position=GCSC_108:624723..622869 (- strand)
ATGTCTTCGTCCGTTTCGGCCATGGCTGCAAACTTCCCCCACCCGCTGCGTGGCGCCTTCACGCCAAAATGTCCCTCGCA
AACCCATGTCTTGGCCACCTCGTGGGTCACACCTCCAACACCTCAGGACTCCCAGGCGTCGGAGAGTACCCCCCCTTCTC
CAGACACGTCGCACATGCTGCCACCAATGACGCCGCTCCAGTCGGCTGGCCTCCTGTCTGCTGGCGGACAGAGCATGGCG
GCAGAAGCAGCTCTCCCAACACCAGAACAGACGCCGCCGTCGCCACCGCACCGCATTCGCTCCAACAGCTCGTCGCTTGG
GCCTCGTGGCCGGGAGGCCCGCATGCAGCAATGGCTGACCGACATTCCGCTACCCATGTCACCACAGGAACGATACCTCC
AGGGGCTCAACCCCAAAACCAATCACCCGCTGCACCCCCAACCGCTCAAGCTGCCCTCGTCCCGCCAGGTCCGACTTGTC
AGTATCGGCGAGGAGGGCAGACATGTGAAGCTCGACAACCACGACAAAGAAAATGTGGACCATGTCCCGGGCTGGATTCC
TCTGGAAAGCAAGAAGAGGCACAACTCGGAGGTTTGTCTATCTGGTTGCCTAACCGACCCTACCGATGCACTGGAGCGCG
CTACTGACACAGAAGCAGGAGCTGGACGGGATGCTGGCGCGAAAGCGCACCAAGATTCTCGACCCGGTCCGGCGGTTTTC
CCAAAAGGTCTCGTCGTCGCTTGCCTTGGCCCCGGCTATCGAAGAACTCGTCGAGATGGCTGCCGTGCGGAGACATAGCG
AGACCATGTCGTCGGAGGACGCGGCCAAACAGAGCGAGCAGCCGTATCAGTTCAGCCAGGCGGCCAAGCCGCAGCGGCGA
AAAAGCAGCTTCCGTACATCCCTGTCCAAGCGTCCCGGCTCACTGCGTGCGTCTGGCTCGGGCGCGCTTCGGCGAATGAT
GAAGAAGCCAGCCGTTGGTGCGCATCCCGGCCAGGCTGCTGTCTGGCACGAGGACCGGCCGGACATGATTGTCAATGTCG
CTTTCATAGGCGACGGCCCTGTGGGGAAGAGCGCTCTGATTCGGTACGACTTTGTTCGCTTGGACTGTCTTTGCGAATGC
ACGCTAACAAGGGCGCAGACGTCTTGTCCACGGCACCTTTCCGAAGGATTACGTGCCAAGCGACATTCACGAGAGTACAT
TCCGGCTGACCGTGGACGATGTCCGTGTCCAGCTGAACCTCTCGGAGGCTGGCAGTGGGCACGATGCGGGCCAGCCGAGC
ATCCTTGCTCTGGGCTGGTTCAGTGTGGTTGTTCTCTGTTTTGATGTCGGACGACCGAGCAGCCTCGAGAATCTGCAAAA
GGTGTGTGAGCGATCAAGCGGTATTGCTGTTCGGAAAGATGTGCCGTGCTGACAAGATTCGGTCGACAGTACCGCAATGA
TATCGCCATGTACGAGGAAAATGCAGTCGTCGTCTTGGCAGGACTGAAAATGGATGCTCGTCATCGCCTTCCTCCTCTTC
ACATGTCGCTCGACGACGAGGATGCGGTCCCCGTATCCGTTGCCGAAGTAAGTCTATGGAGCTTTAACGTGTCTTCAGCT
CACGCTAACGCACGACAGGGAGAAGAAGCTGCGGCAAAGATGCGCTGCAACGGCTACTTTGAGTGCTCTTCGCTCGGTTC
CTGCGAAGGGATGGATGCTTTGTTTGACTACGTTTTGCGGTCTGGCGTTGACCTTCAGAAGTTTCGCGACAAGAAGATGG
CACGGTTCCGGCTGGAGCATTCGGTCGACAAGGGCATGGCCAAGATTGCCGACGGGGTCCGATCTCTTTTCCTCTTTCAA
AACTCTAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62