GenePrediction:GLEAN_695 Details

Name: GLEAN_695
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1480555..1483359 (+ strand)
Length: 2805
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1480555..1483359 (+ strand)
Length: 2805
>GLEAN_695 class=GenePrediction position=GCSC_97:1480555..1483359 (+ strand)
ATGGCCACTCGCCTTCAGCCTGAGGCGCCGGCACTGGCCCGCCGCATCAACATCCCGCTGACGGCCACCAGCCCGGCCGG
GCTGATCGAGGCCGACACAGTCGATCCGTGGAACAAATCAGGCAAATACGCGCTCGCCTGGACATACTTTGCCCTGGCCC
TGACCGGTTGCGTGGTGGTCGTGCGGTTGTGGCACTACTGGCAGGACAAGATCCGGCAGGCCATCTACAAGCAAGAGGTT
GAAGAGCACTACCGCAACCTCTATGTGACGAATCCGGAGTGGGAGCAGCCGGCAGCGACAGCAGGGAGCCTTGCGGAGCA
GGAGGCAGCACAGGCAGCACAGGCAGCACAGGCAGCACAGGCAGCACAGGCAGCACAGGCAGCACAGGCAGCACAGGCAG
CACAGGCAGCACAGGCAGCACAGGCAGCGCAGTACGCGCAGTATGCACAGTACGGGCAGCACGGACCCAATGGACCCAAC
GGAACGCCAGCCACGGTCAGCCACGCGTCCAGCCGGCACTTTTTTCCGGAGGAGACGAAGCAGGAGACGGCATTTCGGCC
GACGGGCAACTTCTCATCGGTCGGACCGGTCAACGACGCGATCGCACTGTTCCGGTGGCTGTTTTACCGGCCGCTGCCCG
ACGTTGTGTGGCGCAAGTACCGGTTCACTTTCTCGTCGGTGGCGGTGCTGGCGTGCGGGTTCGTGGCGCTGGCGTTCTCG
GCGCTGTACTGCTTCCTGCCACAGCCGCTGTACTGGCAGAGCATCCGATTTGGGGCTCCGCCGGTGGCCGTGCGGGCAGG
CATGATGGCGGTGGCGATGACGCCGTGGATCATCGCGACGAGCACCAAGACCAACGTGCTGACACTGATCACGGGCATCG
GGCCGGAGCGGCTCAACGTGCTGCACCGCTGGGCAGGCTACCTGTGCCTGTTCCTGTCGCTGGTGCACGCGATCCCGTTC
TACGTGCAGCCAGTGTGGGGCGACGGCGGGATGGCGGTGTTCCAGCGGCTCTTCTCCAACGGGCTGATTGTGTACGGCAC
GGGCATTGCGTGCCTGGTGCCGCTGATCTGGCTGTGCGTGGCATCGCTGCCGATTGTGCGGCGGGTGGCATACGAGGCCT
TTGTGCTGCTGCACGTGCCGGTCGGACTGCTGTATGTCGGGCTGTTGTTCTGGCACACCAAGAACTTTTTGCACTCGTGG
GCGTACCTGTACGCGACGTGCGCCATCTTCGGGGCGTGCCAGCTGTGGCGGCTGGCGAAGCTCAACTGGACGCGCCCGTG
GAGGCTGGCCTTTCTGGTGGGCGACGAGGCGGCGATCTCGCTGATGGCGGAAGACGCGATCAAGATCACGATCCCGACGC
AGATGCGATGGCAGCCAGGCCAGTACGTGTACCTGCGGATGCCGGGCATCTCGCTGTTTGAGAACCACCCGTTCACGGTG
TCGTCACTGTGCAGCGAGGACTTCCCGTCGGCCTACGGTGATGCATACCGCGACTGCGTGCTCGTCTTCCGGCCGTACGG
CGGCTTCACACGGCGCGTGCTGGACACGGCCGTTTCCAAGGGACCCTTCCACACATACCGAGCCTTTCTAGACGGGCCAT
ACGGCGGGATGCGGCGCGAGCTGGCCGCTTTTGACACGTGCATTCTGATTGCCGGCGGCTCGGGCATCACGTCGCTGATG
TCGCAGCTGCTGAACCTGATCAAGCGGATGCGTGACGGCAAGGCCATCACCAAGCGGATTGTCGTCGTCTGGGCGCTGCG
CCGCCTCGAGGCCATGGACTGGTTCCGCGAGGAGCTGCGCATCTGCCGCGAGTCGGCGCCGCCCGAGTCTGTGACCTGCA
AGTTCTTTGTCACGGCGGCGACGCGCGCAGAGCATCGAAACCCGCATCTCGGCGGAGATGCTCTCGGCCTGTTCGGCGGG
CCCGATGCGACGACGAGCAGCGTTGTCTTCACCCCGGGCATGGGAGGCATGGGTGCCCACCACCAACAGCGCGCACCCCG
ACCGCTCAGCAACCTCTTCCACGACCGGCTCGACGGGTTCGTGGCCGGCATCGCATCCAAGCGCAATTCAGCCCTCATTG
TGGCCGAGGCCCAGGGCGATCCCGAGGTTGAGCGACAGCTGCGCGCCGAAGACGAGGACCGCATCACAGCCCTGCCCCAG
CAAAAGTACCTGCAGCCGTACCAGATGCAGGTCCCGCTGCCGGACGAGTCGCTGCGCCGGCTGGAGGGCCGTGGAGAGAA
GCAGGCGGCCCAAGCGACCGAGGCGTCTCAGCCTGGCGAGTTCCACTTCACGCCGCATCCACGAACAGACGCGCCGCACT
TTAACCTGGCGCCACCAGTCCTGGCAGCGAGAGAGGCAGTGGGCTCGGGCGAAGACGAGGGTGAGAACGAGAACGAGACG
ACGTCGGAAGCCCAGATGCGGCCGCCAGAGTTGGCACACCTGCGGACAGACAGCGGGCCGACGTCGACGTTTGGGCCGCC
GTCCGGCTTCGACTTTGGCTTCCCGGAGACGCCGACGGAGTTCCAGCGATCGCTGATGCGGTTCGCCTTTCCGGTGCCGC
ACCAGATCGACGGCGGCTGGAGCGTGGAGTACGGACGACCGGACCTGGGCTACATGCTGCACGAATGGGCCCGAGGGGGG
GCAGACGGGCGCGGCATTCTGGGACGGCGTACAGCCGTGTTTGTGTGTGGGCCAGCGAGCATGCGGGTGGGCGTGGCGAC
GACGGTGGCAGCGCTGCAGGCGGAGATCTGGGGGGACGACATGTTGGAGGAGATATTTCTGCACACGGAGAACTATGCGT
TGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62