GenePrediction:GLEAN_6965 Details

Name: GLEAN_6965
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:589660..585818 (- strand)
Length: 3843
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:589660..589318 (- strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_108:588828..585818 (- strand)
Length: 3011
>GLEAN_6965 class=GenePrediction position=GCSC_108:589660..585818 (- strand)
ATGGCGCCACCAAACCCGGCGGCCCGCGACTCGGAGGGTGCTGGCGGTAAGGGCGGCAACGTGCCCGGACGTATTGGACG
GCCGCCGCAGTGGACAAGCACGCGGTCGCGGAAGCTGGCACGGCTGTACATGTACACGACGCTGTCGGTGGACAAGATTC
TCAAGGTGCTGGAGGACGATGTGTTCAAGCCGCGCAAGAATTCGGCGCAGAAGACGATCCACAACATGCTCGACCACGAT
CCGAGATACTTGCGGCCCGAGTCTCGTGAGGACATGAACCAGCGCATCAAGCTTTTGTCAGCGTCGACGCAGCGGACCCG
CAAGTCTGCGAGGGACCGGGATGGTGATGGAGAGCTCCAGCAGCCATCACCGCTGCAACACCAGCATCAGCAACAGCACC
AGCAGCACCAGCAGCACCAGCAGCAACACCAGCAACACCAGCAACACCAGCAACACCAGCAACACCAGCAACACCAGCAA
CACCAGCAACACCAGCAACACCAGCAACACCAGCAACACCAGCAACACCAGCAACACCAGCAACACCAGCAACACCAGCA
ACACCAGCAGCAACACCCGCATCACCAACACCAGCAGATGCACCAACAACACCAGCAACACCCGCACCACCCGAATCACC
AACACCACCCGCATCAAGCTCCTCTGCAGTCGCCCGTCTACGGCGGCAACGGCATGGGGATGCACCAGGTGAAGCAGGAG
TTGGCGCAGCCGATGATGCTTTCACAACACCTCCACCACTCGCAACAGTATCATAGTCATCAGCACGCACCGCCGCCCTC
CCTACCACCACCAACGACTCAACCGGCGGCAGATTATTTCCCCCACCCGCCAGACCCCAGCAGCATGCACCAGCAGCCAT
ATGCCGACTTCTACCACCCACAGTACCAGCAGCAGGCGCCACCGCCGTCACAGCACCACGCGCTGTCAATGCAGTCGATG
ACCCACCACGTTCCAGCATACGTGGGCGGCAGTTGGCCGGGATTTTACCCGACCCATCCGGTGGGTACCAGCGCAGCCGA
CGTAGAGGCAGCAACGCGCATGACGATCAGCAGTGCGCCCTTTGACCTGTCACAGCACTCACCGGCGGCCCTGGCAACAG
CCGGGATCCACCACCACGGGGGCCACCATGGAGGGCACCACGAGCTAGGCGTGTCCCTGGATGGCAGCTCGCCGACGAAC
GGCATGGGACTGCCACTGTATGCGCAACAGCAGCAGCAACAACAGCGGGAACGGCGGTCAAGCACGGGGGCCTGTTCGAC
GGCGTCGTCCGACGTCAGCACGGAGACAATTCAGGACCTGAAGAAGCGACTGTCGGGCTGCTCGACGCACTATGCGAACC
AGGTGTCGAACCTGCTGCGGCGATTTACGATCAGCGTCGACTCGGACGAGGCGGGCGTGCCGGTGTTTGAGCCGGACACG
GATCCTCACCGGGTGCGGAAGCACCGGCGCAAGAACAACAACATGAACAGCAGCAGCAACAAGAACCACAGCAGTGGCAC
CAGCAACGGCCGGAAGAAGGCGCGGAGCGGTAGCGTGAGCAGCGACAGCAGCGCGGTGAGCAACAGCTGTGCGAGCGAGA
GCGACGGCGAATACGACGGCACGTTTGGGCCGGGACGGAGCAGCAGCAGCGGCGGTGGTGGCTTCCACAGCCACAGCCAC
AGCACCAGCATGAGCACAGGCGACAGCTCAGACGCGTCGGGACAGATGCGCGACGATGAGCGCAAGCAGCAGTTGTGGCC
GACACAGGGAAACCTGCCGGTATTTCTGGGAGCGTGCGGTGACGGGGTGGGCAGTCCTCGGCTGGCGCTGCCGGGCGACT
TCTTCAACGCATACCGGTACCGAAACGAGGCGTGTCCGCACCATCGGCGACAGCAGCAGCAGAAGCAGCAGCAGCAGCAG
CAGGGTGACGGTCTCGGCGGGATGCCACAGCCGATGGGAATCCATGGCAGCCGGTTGGGTGGGCGAGATAAAAAGAAGTC
ACGCGAGCGGCGATACTGGTGTGCAGTGACAGAGGCGGTGTCAGCAGCAGCAGTGGACAACGGGTCTTTCTGGGTACTGG
GTGACGGACGATTGGCACCAGAGGCGCAGGCGCTGCTGCACGAGACGGCACCACACAGCATGGGACGACGGGACCGGTTT
GGACACACGCTGCTGCACCTGTTTGCAGCACGCGAGGGCGTGCAGATGCAGCTGCTGGCGATGGTGCTCAACAGTGACGA
CGACAGCATCGTGGCGGCCAACACGGCCGGACAGACGTTTCTGCACTTGCTGGCACCGGGCTGGTTTGTCGGGCTGCACG
AGCCGTATGCACCGCTGCTGCAGCTGCTGACACACCTGCGGGACCGCCGGGGAAGCAGCAGCAGCATGGGCGACGATGGG
AGCGCGGCAGCGGCCTTGGCAGCAGCAGCAGCATCAGCAAGCGGCAGCAGTGCAGTCTCGCCGGCTCATCTGGTGTATGC
CACGGACGTGTACGGCCGGTCGTTTTTCCACCGGCTGCAGATGTTTGTCGACGACCCGGTGATCCTGGCAGGCATTGCCC
AGCACTACGAGCGGGCAGCACTGTCTCGTCGGGATGCCTTTAACAACCTGCCGCTGATGGGCGGCAGCAGTGGTGGTGGG
GGCAGCAGCTTGGACGGGAGCGACAGCGGCGGGGGTGTGGTGATGCTGGACGACGTGGTGCCGCCGTGGCAGTCATCGCC
GCCGGCAGAGGGCAGCGGGGGTGCTCTGGGCAGCTCTTCACGGTCTCCGACACCACGCAGCGGCACGGCAACGGCAGCAG
CAACGGGCGATGGGATCGATGTGGATGAGGGCATCAGCAGCGTGATTTTTGCGAGCGAGGATGCCTTCATCCGGCATCAC
GAGTCGCTCCTGCGCATCGTCACGGCATCGGACAGCCACCCGAGCATGGAGGACCCCGAGGGCCGGAACGGGCTGCACTG
CCTGGCGCAGGCGATTGTGGACAAGCGGATGATGGACGAGCACCGCAACGCCATCAGCACGGGCCGGCGGCCACCGAAGA
AGAAGACGATGGACAAGCGGGGGCCAGACCTGCTGAGTCCGGGCAGCAGCAGCAGCACGGCAGCGACGAGCCTCGGCACG
ACGGCCAGCACGACGACAGCTCTGAGCACGGCTCCGAGCCTGAGCACGACGCCGACGAACTCCATGTTTCTGGGCAGTCC
GATGGGGGCTCTCGGGGGTCTCGGCAGCATCGGGGGAATCGGAGGAATCGGCAGTCTCGGAGGGCTCGGAGGAGCGACGT
CGTCGGCCAACCTGTTGCACACGTCGGCCGACGGGCCACAGATGGCGACACGGCTGCGGCTGGTGCAGGGGCTGCTATCG
CCACCGACGGTGGTGGACGTGAACCATTACGACCGACGAGGCCAGACGGTGCTGACGTCGTTTGTGGTGCACATTGCAGA
CGACCAGGAGGACAAGGCCAAGAGCCTGGCGGCGATTCTGGAGACGCTGCTGGCGGCAGGTGCACGCATCGACGGACGCA
ACCGTCGTGGCGAGACGGCCCTGCTGGTGGCCGCGCGGCTGGGCCGCAAGATCGCCCTGACGACGCTGCTGGACCACGGC
GCCAACGTGCACGTGCGTGATGCCGCTGGCCGCGGCGTGCTCGATATCATCGATGCCCAGTGCCGCCAGCGGGCGCGTCA
CGACGTCGCCCTGTACGGTCGACTCGAGGCTTGCCGCGTGCTGCTGACGAGCATCAAGCAGCTGCCGCTGGGCGTGTGCC
AGCGGCCGACCCTGCTGGACGAGTGGACCGTGGCGAGCAGCCGGCGTGGGCCGGAGCCGCGGGATATGACGATGGTGATG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62