GenePrediction:GLEAN_6966 Details

Name: GLEAN_6966
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:574382..572513 (- strand)
Length: 1870
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:574382..574005 (- strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_108:573933..573485 (- strand)
Length: 449
Type: CDS
Source: GLEAN
Position: GCSC_108:573425..572513 (- strand)
Length: 913
>GLEAN_6966 class=GenePrediction position=GCSC_108:574382..572513 (- strand)
ATGTCTGGTATTGAGGTGATAGGACTGGCCCTTGCCTTTTGGCCGGTGGTGGGAGCTATGAAAGAGCTGTATGATGTTAC
AAAAGGCGGGACGGGTAAAAGCTTGGCCTTGACTATCCAGGTGCAAGAGCGAATATTCAAGGAGTGTGTGCTCAAACTCT
TGCAAAGTGACGAAGATCTTTCGGAAAAGGACCGTGCCGGGCTTGCCAACGGCGAGAAGAGCTTTGAGAGCCTCTGGAAA
GATGCAGAGTTTAGCAGCCGGTTAGAGAGCCGGCTCGATCCTGAGATGTGCATTCTGATCAAGCATCAAGTCGGCCAAAT
CTCGAAGATGGTAGCTAGCCTCCAGAAGCTTGTTGGTCCCTCAAAGACAGAAGGCCCCGTGAGTGCAATCGTGCTCTACA
CTGCCCTCTTTTCTGTGCTCGTGTGCTGACCCGCCTTTGGACATGACAGAAAAAGAGCGGTAGCACGATCATGACAGGCG
TCAAACGCGTGCTTAGAAAGGACGAAATCAAGAAGGGCATCACCAGTCTCGCACAGTACAACGATTCGCTCCGAAGACTC
CTCGAATCCTGCTCGAACACGGCATATGCTGATGCGAAGCCGTCCACAGCCCGGACCCATCACCGAAGACAGTCCCAGGA
AGTTCGGCGGAGGGGAGAAAACACCCAATTTTACAATGGCTTTCATGAAGTGCTTGGGAAGAGCTTCAGATGCAACTGCT
CCCGAGGCCACCAGGCAAATCTGTCCGTCTCGGACACGTTTGTAATGTTCCAGGCCGAAGAGCTGACGAGGGCAATGTCG
AGTTTCCGGCTCCGAGAACGGTCAGATACGATAGAGAGCGACGTCACAGCAGTTGGTTCGCCAACCTGTTCACCAGATGA
GGAGGAGGATGATATGAGGTCGGTGTCTCTTGTGGTCCCCCAGGCTGTTTCGTCTCTTTCTGACCTCTGCCTCACAGCGA
GCTGATCCGGTCCACATGGTCGCCGGCACGAAACGGCAGTCAGGCGGCGCAGCCGTGCGAGCAGGCGGCGCTGCTGGTCA
AGTACAGCGAGATCCGAGGGGTGCAGAACTTCACGCCGATCCCCGACCTCTGCCAGTGGATCCACACGGTGCGCATGTCG
CCTCCCAACTCGCCCGGCATCTCGGAGCTGAACGGGGTGCTGGGCAACGACAGCAATCGGTACACGGTGCGAGCGCCACG
GCAGAACGTGCCGATGAGCATTGTGCCGATGGACCAGTGGCTGACATCGTGCGGCACCGAGCGCAAGAAGCGGCGGGTGC
GCGCAGAGCTGGCAATGAACCTGGCGTCCACGATCCTGCAGTTCTACCCGACGCCCTGGATCGAGAGCTCGTGGACGTGG
CGCAACTTTTCGGTCGCACAGGACGACTCATCGCATCACCTCGTCATCACGCAGCGGTTCTGGTCCATGGACATGCCGCG
GCACAGCCTCACGCCAGCGCCCAGCCGGTTCTGGCAGACCTTTTCAGACCTCGACCCGATGCTCGTCCGGCTCGGCTTTG
CCCTCATCGAACTGGCCCTGGGCAGGCGGCTGTCGGACATCCGGACAGACAACGAGAGAGGGGACGAGACGGACGTCGTC
GTCGATGATGGCCGCCAGGATATGGATCTGGCCGACTACTCCACTGCCATGGCCATCCTCCAGAGCAACGAGATCCGCGA
CGAGATTGGCAATGCCTACCAGTGCGTGGTCGACGCGTGTCTCCGCTGCCGCGTGCTCAGTGATGACGGCTTGATGGTGC
TCAAGTCAGACTTGGGACGATTCGAGTCGGATCTCGAGCAGTTTGTCGTCGAGCCGCTGCGAGATTACCACTCTACCATT
TGGGGAAACATGCCGGTCGCCACGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62