GenePrediction:GLEAN_6968 Details

Name: GLEAN_6968
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:565258..559636 (- strand)
Length: 5623
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:565258..563408 (- strand)
Length: 1851
Type: CDS
Source: GLEAN
Position: GCSC_108:562669..562418 (- strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_108:562353..562234 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_108:562176..560956 (- strand)
Length: 1221
Type: CDS
Source: GLEAN
Position: GCSC_108:560889..559636 (- strand)
Length: 1254
>GLEAN_6968 class=GenePrediction position=GCSC_108:565258..559636 (- strand)
ATGGCCATCCAGCGCCTGCCAGGGGATGTGGTCGTGCAGATCGAGGCCTCCCTTATCGTGACTTCTCTGAACGGCACCGT
CTGCGGCCTGCTGTGCAACGCTCTCGATGCTGGCGCCTCCAACGTGAACATCTCCGTGCATTACAGCCATGGCAGTTGCG
TGGTCGAGGATGACGGCATCGGAATCCCACCGCCTGCGTTTCGTCCTGACGGTGGCCTCGGACAGCTGCACCACACATCC
AAGCATCCGCGCAGCATCTGTCTGCACGGTCGCCACGGATCCTTTCTGGCCTCGGTCGCCTCGCTCTCACTGCTGTCGGT
CGTCTCGCGCTGCCGCGGCCGTGCGTCTCCCAGCGCGCTGACCATGCACAATGCAACGGTCCTGCGGCGGCACGTTCCTG
CTCCGCCAGAGCAGCACGCATGCCCTGCGCCACATGGCACCCGTGTTGCCGTGCACGATCTCTTTGGCTGCATGCCGGTG
CGTCTACATCTGCGGCCGGCCTCTGCTTTCGCTGCCTGGAGCCGCGACTGGGACGAGCTCGTGCGCTCGGTCACCGCTCT
TCTTCTGGCATGGCCACACGATCTAGTCGTTCGTCTCCGAGCTGAAAGTGGGACTGGTCACGGCCGCCTTCCTGCCGTCA
CCCTCCGTGCTGCGGCACCACCTGCTGCCGAGCATCCCGCCATAGCACGGACGACAACACTGCTGGCACAGGCAGGGCTT
TGCGATACGGCCAGTGCGGCGTCGTGGGTCCGCGTCGGCTCGTCCATTCCCGGTATCACAGTCAGTGGCTGTGTTTGCTT
GACGCCGTCTGCTTCCAAGCGTGTCCAGTTCATCAGAATAGGCGTCGAGCCGCTCTCGGAGAGGCACCATGCAGATCTGC
TTTACGACGAAATAAACAAGCTGTTCGCCGACTCGCTCTTTGCCCTGGTGGCGGCGGTACAACGGCCGACAGCTGCGCGA
AGAGGAGTTGATCGGTGGCCGATGTTCATCATTGGCATAGACCTGACCGAGTCGGCCCCAGTAGAAGTTGATGATGTTCT
CGACGACAGACGGCAGCATCTGGCGCTTGTCCGATCCCTGCTTCGGACGATGATTGTCCAGTTTCTGAAGAAGCATAATT
TGTACAGGCGGACCACTCTGCTCTGCGAGGACACTTCTTCTGTTGGCAGCCCCAGCATAACTGGCCCCCCTGCTAAGAAA
CGGAAAACAACCAGAATGTTGCAACGACACTCGCCCTTCCGGTCCTGGCCAAAGGTCAAGGCGACGCGGCCTGGAGCTGA
AAGAAACAGATCAAAGGACGGCACACTGATTTCAGGCGCAGAGCTGGAAAGCGCGCAGCCTGCCACCCTCTCGTCGCCCA
AGACTACAAGCAAGTTCTTTGGTGGCGCAATCAGTACAAAACTCGATGAAGGGTGTCGAGCCAGTGGCACAGCCGAATGG
GACGGCAACTCCTTCTCGAGCGGTAGCATCCGCATATCGAGAGAGAGCCTCGCTGCTGCCAAGGTCATCGGCCAGGTGGA
CCAAAAGTTCATCCTTGTCAAAGTCCCGGCTCTTGATGGAAACCCCGACCCTTTAGGTAGTAGAGAGAAGGGCGAGGTTC
TGGTTCTTATTGACCAGCATGCCGCAGACGAGCGTTGCCGCATTGAGGCTCTGCTCACGGAGTATTTTGTATACACGCCG
GGTGAAGAGAGCGTGTTGGAAGCCCGGACAACTGCGTTGGAACAGACGCTGCAGTTCGAGCTTGACGCCCATGAGCGGCC
TCTTCTAGAACGGCTGCAAAGCCATTTCCACTTCTGGGGCGTGGTGTATACTCTGGCTACCGCGGACAGAGACGACGTGG
TGGCGCTGCGGGTGCACAGGCTTCCCGAAAGTATTCATGAGAGATGCCTTCACGAGAGCAGGCTGGTCGTCGAGCTTATC
CGGAAGGAAATGTGGACACGTCACGAGTCAGCTCATCTGCTGGGATCCAGCCAAACTTTGGATGAGGCGACGAGGATGAG
CACCTCATGGCTATCTCGGTTTCTCAGCTGTCCTCGTGCTATTCTGGACCTTCTGAATGCAAGAGCCTGTCATAGTATGT
TACCAATCTTTTACATCTTCCGTTCATATGGGCAATAATTGACAGATGACAGGTGCCATCAGGTTTAACGACTGTCTGTC
CCACTCCCAATGTTCCGACCTGCTCCAGAGATTGCTGCAGTGCCGTTTTCCGTTCCAGTGCGCACACGGAAGGCCATCCC
TAGTGCCACTTCTTAATTTGGGCACTGAGTTTCCGGTAGGCAGCTCGTCAAGAGAAGATTGCGGTTCCGGGATGTAGAAG
AGTACGAGTTTCACGATTTAGAAGAGTATCCCTGTAATAGAATTAGGCCTAAATGAACATGTCTAGCAGAGGCCCATTTT
ACGCCACACGCTCAGCCACACGTGATAAATTACGCTAATCAACGTCACTACGGCTACTGCGCTGTCGCGGAACATCCGTT
GGGACAACATTAAATTGGCGAGGATAATGTGACCATGGCCAACTCGGTAGGCTTGCCCTTTCTATGGCGTGGAGGGTGGA
TGCGTGGGACGATGTGCTAACCCCAATAGTGGAAGTCGTTTGACTTCTTCGATGTCAGCCAAGCGAAACCCGGCGAAGAC
AAGACAGACGTCGTGTTTGAGGGCAACGAGATATCGAGCGTCTGCTCCGGATCAGAAAGTCTGTTTCTTGGCAGCTACGA
CGGATATGTGCGCATTGTGGGACCGAGCTGGAAGGTGGTGCGGAGCTTCCTCGCACACGAGGCGGGAAGCATCACACAAA
TGCGGCAGGTGGAGGGAACGAGTCTGCTCGTGACAGTGGCAGTAGGTTCTCGGGAAATGGATGCGGGCGGTGCCGAGACG
GACGTGATTACTGACGACGGGACAGGAGGACATGAGCACGGAGCCGGTGCTCAAGGTGTGGGCGCTGGACAAACCGGTGA
AGAAGACGGGGGTGCCGACGTGTCTGAGCACGATTGAGGTCAACAACGGCAAGAAGCAGTTTCCGGTGAGTTGTGGGGCG
GGACTATGAAGCGAGCGTGGTTCATAGCTCTGACGCGGGAAGATCTCGGCGTTCACGGCGACGGCCGACCTCTCGCAGCT
GGCTGTCGGGTTTGCCAACGGGGCGGTGACGCTGATTCGAGGCGATCTGGTCAACGACACGGGCACGCGACAGCGCATCA
TCTACGAGTCAGAGGAGCCGGTGACAGGAGTGGAGCTGTACGTGGACGACAAGTTCACGACGACACTGTTCATCGCGACG
ACGGCACGGATCCTCAAGCTGCCAATCCTGGCCAAGGGCAAGGCGCAGGCGGCCAAGACGGTCGAGGATGCCGGCTGCGG
CGTGGGCTGCATGACAGTCGACCCGCGGACGGGCGACATTGTGGTGGCGCGAGACGACGCGATCTACTCGTACTCGCTCG
AGGGCCGGGGGGCGCCGCGGGCGTACGACGGACCGAAGAGCCTGGTGGTGGTGTACGGCGACTACGTCGCGCTGGTGTCG
CCGGGCAGCAGCGGATCCAACAGCAACGGCGGACAGCAGCGGCGACGGCTGGGCGGAACATCGACGTCGGCGGACGCGCT
CTTCAGCACGACGACCCTGTCGGTGCTGGAGACGGACCTCAAGGTGGTGGCACACGCGGAGACGCTGCTGTCGCCGGTGC
GCAGCGTGCTTGCGATCTGGGGCCGGCTCTGCGTGCTCACACAGGACGGCCGGGTGCGGCAGTATGCGGAGAAGACGCTG
GCACAGCGGCTCGACATGCTCTACCAGCGCAACCTGTACCACCTCGCGATCGAGCTGGCGCGCAAGTGCGGGCTGGACGA
GGCGGAGCAAAACGTGATCTTCCGGCGGTTCGGCGACTACCTTTACCGCAAGGGCAGCTACGACGAGGCGATGGCGCAGT
ACATCCGGGCGATCGACAGCACGGAGCCGTCGCTGGTGATCCGCAAGTTCCTAGACACGCAGCGGATCCACAACCTGATT
GAGTACCTGGAGCAGCTGCACGAGCACGGGCGGGCAACGGCGGACCACACGACGCTGCTGCTCAACTGCTACGCGATGCT
GAAGGACATCGACAAGTTGGAACGGTTCATCAAGTCGCCGGGCGACCTCAAGTTCGACCTGGACACGGCCATCTCGGTGT
GTCGGCAGGGCGGGTACTACGAGCAGGCGGTGTACCTGGCGAAGCAGCACGGGGAGAACGAGCTGGTTGTGGACATTCTG
GTGGAGGACGCGAAGAAGTATGACGAGGCGTTGGCCTTTATCGGGCATCTGGATCCGAAGACGGTGAGTAGGGGAGTGGA
AGACCAAAGAAGACAAAAAGGACAAAAGACCAAGCAGCTAACAGTTCAGACACATGCATCGCTGATGAAGTATGCCCGGG
TGCTCATCGAGAACTGCCCCCAAGATACGACACAGCTGTTTATCGACTACTACACGGACAGCTACAAGCCCAAGGCCGAG
GAGGAGGTGTTGCTGGGCGGAGCGAGCATGACGTACAAGGCGCCGGCGCCACGGACAGCGTTTTCGTCGTTTATCGATCA
CGCGGACGAGTTTATCGTGTTTCTGGAGGCGTGTCTGAAGGCGCCGTCGGTGTCGTCGGCGGACCGGACAGACCTCAAGA
CGACGCTGTTTGAGATGTACCTGAGCAAGGCGTCGGACAAGAAGCAGCAGGGCGTACAGGAGCGGGAGGGCTGGGAGGCC
AAGGCGAAGGGGCTGATTGTGGAGGGTGGGAGAGCCGGAGCCGGAGCCGGAGCCGGATCGGGGTCGCACGAAGACAGCGG
GCTCGAGTCGGAGCTGGAGTCGGAGCCGATCGAGCCGGCCAACGTGCTGCTGCTATCGCATCTGTCGGGATTCCGGGAGG
GGACGACGCTGATGAAGGAGCAGGCAGGCCTGCTGTTCGACATCTTCCGATCGTACACGGCAGCACAAGACACGCGAGGG
GCGCTGCGAGCGCTGCACCGGTACGGGCCCGAGGAGCCGCAGCTGTACACGGCGGCGCTGTCGTACCTGACATCGAGCGG
GCGGGTGCTGGAGGAGGCCGGACCGGCCGAGCTGACGGCGGTGCTGCAACGAATTCATCGGGACGGGCTGATGGCGCCGC
TGCAGGTGGTGCAGACGCTGAGCCAGAACACGGTGGCGACGATGGGGATGTTGAAGCCGTACCTGCAGGAGACGATTGAG
CGAGAGCGGCGCGAAATTGCGGCGAACCGGCGACGGGTGGCGGCGTTCCGGTCGGAGACGGACCAGCGACGCGCCGAGCT
GGCCGAGCTGGCGGCCAAGCCGGCCGTGTTCCAGGCGACGCGCTGCAGCCAGTGCGCGCTGCCGCTGGAGCTGCCAGTGG
TGCACTTTCTCTGCAAGCACTCCTTCCATCAGCGCTGTCTGGACGGTGGAGGTGGTGGAGGGGGGGTGGAAGGGGACGAC
GATGACGACGTCGAGTGTCCGCTGTGTGGACAGGACAATGCGACAGTGCGGGCGATCCGGCGGCAGCAGGAGGAGTATGC
GACGCGGCACGACGTGTTTCAGGCAGAGCTGGCCAACAGCGAGGATCGGTTCGGGACGGTGGCGGACTGGTTCCAGAGGG
GAGTGATGAGGATGGGAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62