GenePrediction:GLEAN_6969 Details

Name: GLEAN_6969
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:552075..544203 (- strand)
Length: 7873
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:552075..552011 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_108:551970..548171 (- strand)
Length: 3800
Type: CDS
Source: GLEAN
Position: GCSC_108:547729..547320 (- strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_108:547266..545089 (- strand)
Length: 2178
Type: CDS
Source: GLEAN
Position: GCSC_108:544826..544203 (- strand)
Length: 624
>GLEAN_6969 class=GenePrediction position=GCSC_108:552075..544203 (- strand)
ATGGACTCGTATTGGAACGAGAGCGTCATGATCGGATGCTTGCTTGCGAGAGGTCTTTGCGCGTCGTACGCCGTCGATAC
TGACTGGCTCTTCTTTGCCATCCAGGACAAGATACGGTTACAACGATCGCCGTTCGCGATCACCAAGAGAACGCTCACCC
AATGATCGGTACAACGACCGCGGCTCTCAGTATGGCGATAGCGAGCGGCGCCGTCTCTCGGGTGACACACGCCCCAGCCA
GAACAGCTTCCAATCGAATCGCGACTTCCGCGACCCCATCGCACGCGAGCCTCCGCGTGGGCCCAAGGCGCTGACCGAAC
TGCCTAGCGGTCCACGGGGCAGCGGATATTCCTCCGACTTTCGCGGACGATCTCGCGTGGCCGGCCAGGGCAGGGGTTGG
GCCCGAGATGACAGCAGAGACAAGGGATTGCGGGACCGCGAAGACTTCCGGCGAGAACCACCCTTTCGCGATGACCGCGG
CTGGGACAGAGAGCGAGAATGGCGCGATCGCGGCGATCTCTTCCGGGGACGGCGACCGTCGCCACCACCGCCCGGCCGCG
CCGTTCGGTCGCCTGGACGAGAACTTATGGGTCGAGATGTGACTCGCGATCCACGAGACCCGCGAGATCCTAGAGACCCA
CGTGATCTACGTGACCTTCGTGATCCGCGGGACAGAGACGCACCGCTAAGCAATGATCTCGCCGACCGTCCAAGACGGGG
CTCGCGCGACGGACCCCCGTCTGCCGGCTCTTCGTCGTCCGATCCCGCCCTCAGCGCCCAGTCATACCGAGGCGGAGCCT
CCAGTCGCGGCCGGCCTGTAGCTCCAGGGCGAGGACGTCCCGTCGACTGGGACCGCAACCGGGCGCCGAGACCTGGAAGC
CTGTATGATGACCGGGACAACCGCTATCCCAGGAGCCGATCTCAGGAAGGTCGCTGGTCCCGGAATGAGCGCGACGATCG
CGACTATCGTGAAGGTGACCTGCGATCGAGAGACCCGAGAGATGACCGAGACAATCGTGGCCGCGAGGTGACCTGGCCGA
AACCGGCAGACCGCAGTTCTTTGCCCCGGGATCCGGCACCAGCACCTGCATCGCCGCCACCGGTTGCTCCCTCTGCACCT
GCCTTTGGGTCTGTCCAGACGCGACAACCGTCGTCGTATGAGATCCAGCCCGTGGCTGCCAGGTCTCTCCCATCCGGTCC
CAGATCGGCGACAGACGAGAGACCACCGTCATCTTTCAACCTGCAGAGCCCAACCGTCTCGGACGCACCGGCCCCATTCA
AAGCACTGCCACTTGACGGTGTGGTCGCTATCATCCCCACCGGCCCACGTTCCCAGCAGTCACCGGCAAAGACGCAGCGG
GCGTCAAGCAAACAGTGGATCAACCCCAACACCCTACCGGCGGTCAAACGAAATCCCTCTGTATCTCCCAAGATTGCCCG
GTCCCAGAGCTTTGTGACCCAGCAGTCTCGCCCTTTCCTTCCACGACCCGAGTCGGCTGGCTCCGGACAGTCTGGCGATT
CTGGTGGTGCGAGAAGGCCTGGCAGTAGTGATGCTAAGTCGGACTTGTATATCGACACGGCCAGGGCTGAGTCACAAAGC
GAACCGGGCGAGATCACGGAAGGCTCGCCGGTGTACTCACATGCTCCCGGACCGAGGGATCACCGGGCGCAACAGGACTC
CCACGGCGGTCAGCGCTCCGACAACAAGGCGGACGGCAGCAAGACAAACCCTACCCTACCCTTTGCCAGGAAAGAAAAGG
CTCCCATGGGTGATAGTGGCATGGCGGGCGCTGGAAAGCCGACTGGTTGGCTGAAGAGGACTGCAGTGGATGATAAGCAG
GAAAAGCGCCAGTCAGCCAAGACACTGCAGGAACCGGTTGCTATGGAAGGGGTGGAAACTCACAAGGTGGTCAACACTGT
ACCGGATGTCAAAACGGAGACGCGGGCGGAAGCCAAAGTACCATCCACACAAACAACTGAGACAGCAAAGGACAAGAGCG
CAAAGGAGTCGGCGACGACATCTGATAGTGCAAACGGCAAACCAGACCTGGAGACCATCCCTCTCACCGTATCTGCCTTG
ATGGTCTCGATTCGCCAGGATCTGCTCGATTCGGAAAGACAAGATGGCGCGTCTGACTCGGAAGACGAAGACATGAACAG
CTATTTCGACGAGGAGATCGAGAAGCACGAGGCCGATATCAAGAAACTGGAGGCAACAGCAGACGCTCTGCCAAAGGACG
GCTTGGTTCGCGTGGGACTGGTGGAGTCCATTCTCGCCTTGGAGATTCTCGAGTCCCCACTCAACTTTTCGAACATCGTC
GGCCCTGCGCCTGAGAAAGCCGACCGGGGTATTGACACCAGCGACACGAAAGCAACGCCAGTGGACGTCGCGGTTGATAA
TGCCCCGGCAGAGAAGCGAGTCGAACACAATTCGAGCGAAGCTCTGCAGAAGAGCACGGCAGAGACAGACGACATGGACG
TTGATTCTCCGCCTGCGCCGGCAACTACAACTCCGGTCCTTTCAAGCCCGAACATCAAGCAGGAAGGGGTTATGGCTACC
GCCACGTCTCCGGCTCAAGCTCCTGCCGCGGCCCCTACGACTGTGATCACTACAGCAGAATTCTCCAAAGAGGTAGACAG
CGATGACACAGTGATGGAAGAGGCCACTGGACCTACGGATTTGGGTGCAGCACCGACCCTGCCTCGTTCTCTGCGAGGCA
CGTCTGAAGCTACGACCGGTGGATTCCGGCTGGACGACGCCAATGCTTCTTCGGATTCCCCTCCCGGCCTCGAGCCGACG
CGTGTCTCGCAGCCATCGAGTCCGTCGCAGGCCGAGGATGACGACGCGACGGAGATCGAGGAGATGGAAAATGTGCTATT
GGAATCGATTCGCGTCTACTCGAAAACGCCACCGCTGGAGGATCTTCCAGACTACAGCTGTCCGTCGTGGGACCAAGATC
CGGAGTTTTTGAAGGATTCGGTCCCATTGGCGGCAGTGGACGCATTCGTGGCACGTCGCATACTGGAAGAAGGCACGATC
GAGGAAACCGAGACGCAAAAAGGACAGCAGCAGTACCGGGACAACTACGTGAGCTATCTGGAGTTTACGAGGTCGGATGA
CCCTGTTGCTGCCAAGAGCCGGGAGAAATATCTGGGCGGCAGCGGGACTCTGGAATCAAGCACGAGGATTTCGCCCAGCG
CAGAAGCGAAGCCCGAGGGGGGCCGCGGAACCAATCGACGATTTGCCACAGAGCGCGATCTTGAGCGAGTGCTGCAGGCA
TCGATGCGCGAAGAGGACGAGCGGAAGGAGCGCGAGTTGCGGGCGCAGAAGGAACGATACCGCAGCGAAAAGGAGGCGGA
GATTCCGGAAATGTACTGGAGAGAGGACGAGCGGGAGCGGGAGCTGTTTATCGACCGATCCGGGTTCCTGGCGCCGGAGA
AGATGGTGTCAGCATGGCAGGTGTTGCCGCCTCTGGCTAACTTCTCCGAGGAAGAAGCACAGAAGTTCGAAAAGGCATAT
CTGGAGTATCCGAAGCAGTGGGGCCGGATTGCGGAGAGTGTGGGAACGCGCGACTTCCACGCATGTATCCAGTACTACTA
CTGCGTCAAGAAAGAGCTGCATCTCAAGGAGAAGCTCAAGAAGCAGCCGCGGCGGCGGAAGAAGGCGCGAGCCAAGCAGC
GTCACGGGGTGGCGGCGGAGCTGGGCGATGCAGAAGTGGACGAGGCGGCAGCAGCGGCAGAAGCAGGAGAGAACGGAGAG
CGACGACGACCTCGACGAGCAGCAGCACCGACATGGGGCTTTGAGATGGCAGCAGCCGAGTCGGACAGCACGGCAGCAAG
CGGAACAGGACGTCGGGTGCGAAACGAAGGGGGCGAGAAGGCAGACGGGCGCAGAAACCGGCGGCGTACGGCCAAGGACA
AGGACAAGGAAGCCAAGGAAAAGGAGGGCAAAGACGGCAAAGAAGGCAAGGACGGAAAGCAAGGAAAGACAACACGGGCG
CCAACACCAAAGGGGGGCCGGTCAAGATCCAGCTCGCAAGCACAGGGCAGCCCACATCCGACAGCAGAACAACAGCAGCA
AGGGATGCAGCAGGGGGTCCAGCCAGGTGCTCAGCCAGGTGTTCAGCCAGGTGCTCAGCCAGGTGTTCAGCCAGGTGCTC
AGCCAGGCTCTCAACAGCAGCCACAGCAGCTACAGGGCATGCAGCAGCTACAACAGCAGCAGCAGCTGGTTGGAAAAGAG
GAAACGAGCGCAGCTGGAGGGATTCTGAGCGGTGCTGGCAATGCTGGCGGTTTTGGTCCCTCTGGTCCCTCTGGTGGACA
ATCTAGACTGCCTCCACACTTTGAAGGGGCCATCGGCGGAATTGGTGGTCGAGGCGGCAGCATGCATCCGCCTCCATTGG
CACAGGTGACCGGACTGGTGGCCAGTGTCGGCAGCGGTGACCTGAGAGGGGTGCCGACAGATGGCGGACGGCACAGTTAC
GGATTGGCGAGTGACTCGGGCGGGCTTTCGCTTCCGAGCAACATTGGCGAGATGCTGCAGCCGCCGTCTCTTCGGCCAGA
ACCACCACCGCCGCTGCAGATTGGCATCTCCAACTTTGATGCTGGGGTGATGGGCCCAGACCGCTATCGGGTGGCCCAGC
AGACGTCGAGCTACTGGAGCGTGTCGGAGTGCAACGACTTCCCGGCGCTGCTGTCGTCCTTTGGCACAGACTGGAATGCA
ATTGCAGCACACATGCAGACAAAGACAGCAGTGATGGTGAGTGGGGGGCGCCTGATTACATAAGCGTACAGGGCACTAAC
ATTACGTAGGTTAAGAACTATTACGTGCGGCAGAAGAACGAGAAGAAGGCCGAGTGGGAAGCAATTGCCAACGAGGCCGA
CATCAAGATTCAGCGAAACGAGAAGACGCCTGTGCCTCCACCACCGCCGGCGATGCCGCGAAAACGGCTGGACACGATGC
AGACGACGGGATCGGGACCAAGCCCTCGGCCGATCGCAGCAGCTTCAGCCAAGACTGCGGAGGCGGCAGAGGGGATCAAG
GCCGAGAGCGTGGGACCGCAGCCGACGTTTGGGCGGTTCCAGACACCTGTGCCGCTGGCCATTGCGCCTCAGGCACCGCT
GGTACCGCTGGCACCGCAGGCAGTACCACTGACAGCAGCAGCAGCAGCATCACAGGCACCGCAGGCACCACCGCCGCCAG
CACCGCCTCTGCCACACCTTCATCTGCAGCCGTCTCTGCCGGCACAGGGGGGCAAGCCGGCGTGCGGCGTGGCGGTGGCG
TCCAATGTGCAGCCGTTGGCAGCGCAGCACGGAAAGGGGCCATCGGCTCGGCAGCAGCAGACGGGCACAGGACAGTCAGT
ACAGAGCGGACAGAACGGACGCACAGGACACGCAGGGCACACAATGTCACCGGGTATGCAGCAGACAATGTCGCCATCGG
CACGGCCGATCATGGTGCCACCTTCAGTCGGAATGTCGTATGGAGGCGGCTATCTCGACCGGACGGTGGTGGAACAGCAG
AAGAGTGCAGGATCGGTTCCGGTAGACATGATGTCGCAGCGGGTGCCGGCCTGGGAGAATTCCGGCGAGCCGGTCGATGC
ACGGCTCAAGTCGCTGGCACAGCAGCGAACGAGACAGCAGCAAGAACAACAGCGACAGCAGCGAGAGGGAACACCCCATG
GAGGCAGCGATCGACAGCAGCAGCAACAGCAGCAACAGCAGCCCCTACCACCAGCATCGTCGCAGCCGATGCGCTTCAAG
CAGGAGCCATCAGACGTGCCGCCGCACTACGAGAGCTTTCTGTCGGCGGGTCCAGGCCCGAACAGCCGGGTGCCGCCTCT
GCGCACAAGCGACCTGCCGCTGCAACCGCCGATGCGGGCAGCCTCGTCGACGCCGCAGCCGTACGGCCACGGTCATGGTC
AAGGCCATGGTCACGGTCACGGGCCACACGCGCACTCGCGCACGCAGTCGCAAAACCACAACCACGCAGCTGTGGCACCG
CCCTCGATTGTGCAGCAGCAGCAGCAGCAGCAAATGCGCAGCCTTTTGACGGAGCCGGTGCAGCCTCAGGTGATGGCGGC
TGGCGAGCGACCGATGGGGATGGGAGGCGAACGAGCGATGGGAATGACAGCCAGCGAGCGGTCGATGGGACTGGTCCACG
GCGGTTACCCCGGCGGAATGGGAGCAGGAGCTGGAGCAGCCATTCCGCCACCGACATCGGCACCACCGGCAGCACTGCCC
CCTCCACGGCCGACAGAGCGCAAGTCGAACCTGTTTGCCCTCCTCAACGACGACGCGCCGGCACCGATGTCGACGCCACC
ACAGCCGAAGAGGGTGGCCGACGTGTCGGCCATTGGCATAAGCATGAGCCGGCCATCCTCAACGCCGCCCGGTGGAGCGG
GAGGTGGAGGTGGAGGTGGAGGTGGAGGCGGCGGCGGCGGCGGCGGATATTCGCCGTATGCGCGCAACCGACCACCACCA
CCACCGCCGCCGCCGTCGTCTGTGTCGGTGTCTTCGCAGCCGCCATCGTCCACGGCACCACCGTCGTCCATCATCCCGTC
GCTCAAGCCGCAGGTGCAGGTGCACAGCCTTAGTGTGCCGCCATCGTCCGTCTCAGACCGAGACTATTACAGCCGGAACC
CATACCAGCCACAGCAGCCGCCGCTGAGCTACCAACAGCAACAGCAGCAGCAGCAGTCTCAGTCGGTGGCAGGCAACGGT
GGTGGTAGTGGTAGTGGCGGGGGCAGTATGGTGTACGCTGGCTACGGACAACAGATGCCGCACGCACCGTCTCCAACGCC
ATCATCCCAGTACCAGGGCCACGTAGCACCGCCATCTGGACGACGAGATGGACCGCCACCGCCGTCGGCCATGGCAGGCG
GCCGAGACATGGGCTGGATGTCGCAAGGACCACCGCAGGGACTGCAGCAGGGACTGCAACAGGGACTGCAACAGGGACTA
CAACAGGTGCCCCCACAACAGCAGCCTGTGCGCTACAGCAACACAGGTAGCCCGGCCTGGGGCGCTGGAGGAGGAGGATC
ACAGCAGCAACAACAGCAGCAACAGCAACAGCAACAGCAAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAACAA
GGGCCACCGCCGCAAAGAGACGATCGATATGGCGACCCAAGAATACAGCAGCAACAGCAGCAGCAACAGCAGCAGCAGCT
GCTGCCGCCATCGCATGTGCAGCTGCTGCAGCATCCCCAACATGTCCAGCTTGCCCAGCATCCCCAGAACCTGCAGCATC
CTCAGCACATGCAGCATTCCCAGCTCGTGCAGCATCCTCAACATGTGCAGCACAGCCAGCATCCCCAGCTGGCCCAACAT
CCTCAGCATCCCCAGCATCCTCAGCACGTGCAGCATGTACAGCAGCAGCAGCAGCAGCGGCACGCGAGCCCACACTCCCA
CGCGCACTCGCACTCCCACTCGCACTCCCACTCGCATTCGCACTCGCTCAGCGGCCGATACCACCAGCCATCGCCGGGAC
CACGGTCGGCCGAGCCGGGCGGACCGGGCGGACCTCCGCCTCAGCAGGTGCAGGTGCAGCAGCAGCAGGTGCAGGCGTCG
TCTTCGCCGTACGGACGCTTCGCCACCAGTGCAGGCGGACCAGGAGGACCTCCCCCGCAGCAGCAACAGCAACAACAGCA
GCAGCGGGACGGCCGCTATACGCCCGTGGGCTACGATGCGCGCGGGCCGCCACCACCTCCGTCACAGCAGCAGCAGCCAC
AGTCGCTTGGCGATGGCGGCGCGCCGCCGCCAGGATCGTATGACCCGCGGGACCCGCGGGACCCTCGGAACCGACAGCTG
CGGCCGCAGGAAGACTACGGGCGGTATCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62