GenePrediction:GLEAN_696 Details

Name: GLEAN_696
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1483943..1486062 (+ strand)
Length: 2120
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1483943..1483950 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_97:1484046..1484190 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_97:1484258..1485211 (+ strand)
Length: 954
Type: CDS
Source: GLEAN
Position: GCSC_97:1485262..1485846 (+ strand)
Length: 585
Type: CDS
Source: GLEAN
Position: GCSC_97:1485913..1486062 (+ strand)
Length: 150
>GLEAN_696 class=GenePrediction position=GCSC_97:1483943..1486062 (+ strand)
ATGGTCATGTAAGTCCTTCCGAGTCCGGCCATTCTCTGCCATTGCTCTTTCCCATTTTCCTGCTTTCCTCTGCCTCCTTT
TGGGATATTCTCTGACCTTCCAGGCTCAAGGATCCGTCGACAAAATACAAACCATTTCCGCCAGTACATCTCCCCGACCG
GCAATGGCCCTCCAAGACAATCGACAAGGCGCCCCGGTGGCTGTCGACAGACCTGCGTGACGGCAACCAGAGCTTGGTCG
ACCCAATGGTAAGCGTGGCTGCACTCGCAGGGAACCGAAGGAGACATGCCGATACAAGCTGACAATCGGCTCTAGAACGG
CGACGAGAAGTGGACATACTTCAAGATGCTCTGCGACCTGGGATACAAGGAGATCGAGGTGTCGTTCCCGTCGGCATCAC
AGACGGACTTTGACTTTACGCGGCGCCTGATCGAGACGCCGGGAGCAGTACCGGACGACGTGTACCTGCAGGTGCTGTCG
CCGTGTCGCGAGGACCTGATCCGGCGAACGGTCGAGTCAGTGCGCGGCGCCAAGCGAGCCATCATCCACATCTACCTGGC
GACGAGCGAGTGTTTCCGGCGGGTGGTATTCAACTTCTCCGAGGAAGAGTCGCTGGAGCTGGCCTCGCGGTGCGCCAAGC
TGGTGCGGTCGCTCACAAAAGACAGCCCCGACCCTGAAGTCCGGGCGACCGAGTGGGCATTTGAATTCAGTCCCGAGACC
TTTTCGGACACGCGTCTGGACTTCTCGGTGCAGGTGTGCGAGGCCGTCAAGGCAGCCTGGGGCCCGACAGTAGAGCAGCC
CATCATTTTCAACCTGCCGGCAACTGTGGAGATGGCCACGCCCAACGTATACGCCGACCAGATCGAGTACTTTTGCCGCC
ACATCTCGCAGCGGGAGCGCGTGTGCGTGTCGCTGCACCCGCACAACGACCGTGGCTGTGCCGTGGCAGCGGCTGAGCTG
GCTCAGATGGCTGGTGCCGACCGCGTCGAGGGCTGTCTCTTTGGCAACGGTGAGCGCACCGGCAACGTCGATCTCGTCAC
CCTGGCCCTCAACCTGTACACCCAGGGCGTGTCGCCTCGTGTCGATCTGTCGGACCTGCAGCACGTCATCGGCGTCGTCG
AAGTCTGCAACAAGATCCCGGTCCATCCGCGTGCGCCCTACGGCGGCTCGCTCGTCGTCTGTGCCTTTAGCGGCTCGCAC
CAGGACGCCATCAAGAAGGGCTTCCTGGCCCGCGAGAAGACAGGTCGCGACGCCACCGATCACTGGCAGGTGGGCCCTAC
CTGCCGCTCGATCCCCACGATATCGGCCGTGACTACCAGGCCGTCATCCGCGTCAACTCCCAGAGCGGCAAGGGCGGCGC
TGCCTGGATCATTCAGCAGTATCTTCACCTCGACCTGCCGCGAGGCCTGCAGGTCGACTTTAGCCGCACTGTTCAGCGCA
TGGCCGAGGAGCGTGGCCGCGAGCTGCTGCCCGTCGAGATCACCGAGCTCTTTGAGCGCACCTACTTTCTGCGCGAGAAT
CCACGCTTCTCCCTCGTCGATTACAGCATCCTGCCCGACCGTTCGACCAGCCCGGCCCCTCCGCCGGCTGCTGGCCGCAC
GCAGGACACCAAGAACATGAAGCGTGTCTTTGCTGGCGTCCTGCTCGTCAACGGCGAGGAGCACCGCCTGACCGGCCGCG
GCACTGGCCCCATCTCCAGTCTGGCCGCCGCTCTCAAGCCCATTGTCGGTGTCGACATCGAGGTCAACGACTACAAGGAG
CATGCGGTTGGCCGTGGTCGCGACGTCCGTGCTGCCACCTACATTGAATGCACCGCTGCCAGCAGCCAGAAGGTCTGGGG
CGTCGGCCTGCACGAGGACGTTGTCACGAGCTCGCTGCACGCCATGCTGAGTGCCGCCAGCAATGTACGTTTTTTTTTCT
TTTTTCTTTTTTTCTTTTTAGTTTTCCTATTCGTCTGCTGACACCCCCAGTTTATGGCCAGCCAGCCCGGAACGCCGCAG
GTCAACCGTACCGTCCCCAAGCGCACCCTTAGCAAGGAGCTAGACTTGAGCACGTCCGCAGCTACTGCACCCAAGCCGGA
TCTGATCCAGGCCCTGGAGGCGCGTGCCGACGAGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62