GenePrediction:GLEAN_6971 Details

Name: GLEAN_6971
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:531531..530194 (- strand)
Length: 1338
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:531531..531447 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_108:531377..530194 (- strand)
Length: 1184
>GLEAN_6971 class=GenePrediction position=GCSC_108:531531..530194 (- strand)
ATGTCGACCTTTGAAGAGGTCATCGCCGGCGCGGTGGCCGACCGTGTCATCCCGGGCGTCGTGCTGCTGGCCGAGGATCT
CAAGGGTCTGTTGTTTCTTCCATTCTGTTCTTTGTCTTTTCCCGGCCGAAACGACTGACCGGACGAACCTGCAGGCTCCC
ATTACGAAAACGTCCTCGGCTTCGGCTCTCTGGCCGCCGACGCGCCGGCCGATCCGCTGCGTCTCGACTCCGTCTTCGCC
CTCCTGTCGCTGAGCAAGCTGGTGACGGCCGTGCTGGTCCTGCGGGCGGCCGAGCGCGGCCTCGTCCAGCTAGACGCCGA
CGTGGCTCCTCTGCTGCCTGAGCTGGCCGCCCAAGCCGTGCTGACGGGATGGGACGACGACGAGAAGCCGGTGCTCGAAC
CGCGCACGGCACCCATCACGCTGCGGCTGCTGCTGACCCACAGCTCTGGCGTCGGCTACGACTTTCTGTCGCCCGAGCTG
CTGCGCTGGACCGCTCATGTCCAATACAATAGCAGCAGCAGCTCCCCCCCTCGAACGATGCCCTCTCTGGACAAGACCCT
GCCGATCGAGCAGCGCTTTGCGGCGCCGCTGCTCTTCCAGCCCGGCGCCGGCTGGGTCTACGGTGCCGGGGTCGACTGGG
CCGGCCGGCTGCTGGAACGGGCGACCGGCACCGCGCTCGAAACCCTCCTGATCCACGACGTGCTCGTGCCGCTCGGCCTC
CCTGCCGGTGCCCTCACCTTTTATCCCGCGCGCTACCCGACAACAGAAGCCCGACTGGTGCGATCGCTGCCCATGCGCAG
AACTGCCGGCTCCGCCGTCGTCGACCGGCCGTCGCCGCTCCTCGCCAGCACCGATCCCCTCGGCCGGACTGCCGGCACCG
CCAGCGGTGGAGGGGGCCTCTTTGGCGATGCGCCCGCGTTCATGCGCCTGCTCACGGCACTGCTACGCGATGATGGCCGC
TTGCTGTCCTCTACCGCCCTCCTCTTCTCACCCCAGCTCCCGTCCGACGCCGCACGCGCTGCCCTCCTTCACAACACGCG
GCCACCTCACTCGGCCTGGATGGTCGGGGACATTCCGCCTACGGAAGCCTATGACTGGAGTCTCGGCGGCCTTTTGGTCA
CGCAGCCAACAAACCATCCGTGGCGACGGCCGGCTGCTCTCCTCTGGAGCGGCGCCGTCAACCTCACGTGGATTGTCGAT
CGCCAGGCCGGCCTCTGTGCCCTATTCGCCGCCAACTTCCTCCCCTCGGCCGACGTCCAGGGCCGCCAGCTGATGCGCGC
CTGGGAAGAGCACGTCTACGCCACAATGGGCCACAGAGCGGAAAGCGGCAACCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62