GenePrediction:GLEAN_6972 Details

Name: GLEAN_6972
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:520318..517774 (- strand)
Length: 2545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:520318..519260 (- strand)
Length: 1059
Type: CDS
Source: GLEAN
Position: GCSC_108:519191..518178 (- strand)
Length: 1014
Type: CDS
Source: GLEAN
Position: GCSC_108:518112..517774 (- strand)
Length: 339
>GLEAN_6972 class=GenePrediction position=GCSC_108:520318..517774 (- strand)
ATGGCTGAGGCATATTCGGAAAAGAAGGTGGTGCCGGTGGTGGGCGATGACGAGAAGCTCGGACTGGATGGAGTCATCAG
CGGGGAGATGCAGGCGGCGGGCCTGAACAGACACGACAGCGGCGAGGACAGCGACAACATTGTGATTCGAACGGGTGCCG
ACGCAGCAGTGCATCTGCTGCCGATGCGTGACGACTTTGACAGCGCGCTGACGGTGCGCAGTATGGTGCTGGCGTCGGGC
CTGGCAGCCTTCCAGGCGGTCATGAGCCAGATCTACACGTTCAAGCCGACGGCGGTGACGATCTCGGGCACGTTCATCGT
GCTGATCGGTTACTTTGTCGGCAACGCCTGGGCCAAGTTTATCCCGCGTGGTGACCACCAGCTGGCGCTGTGGCGGGAGA
AGAAGGGCTTGCCACCGACGGCGGCCGTGGTCCGGACGGGGGATTTCCACGAACATGCCGCGGATGCCGATGCCGATGCA
GTCGGCCAGATTGCTACGACTGCGGCCGCCGAGGAGAAGCCGCCGCTCTGGATCCGGGCGCTCGTACTACTCAACCCAGG
ACCGTGGTCGCTCAAGGAACACGCGGTGTGCTCGATCACGGCGACGTCGGCATCCAACGCATCGGCCAGCGTGATGGTGT
TCTCGGCCCAGAAGCTTTTCTACAGCATGGACGTCAGCGCGGTGACGGTGATCCTCAGCACGATCTCGATCGGCCTCTTC
GGCTACGGGCTCTGCGGCGTGCTCCGACCGATCACGGTGTGGCACGTCGAGTCGGTCTACTGGAGCACGCTGCCGACGGT
CAAGACGCTGCAGGGACTGCACTGGCAGGACGTCAAGAACTCGCGGCCGCTGCGGGTGTTCTGGTACGGCTTCCTCGGCA
TGACGGCGTACGAGTTCTTCCCGGCCTACATCTGGCCGTGGCTCAACTCCGTCTCGATCCCGTGTCTGGCCGCGATGCAC
ACGCACGGCAGCCGGGCCGACATCGTGACGAACCTCTTTGGTGGCTCCATCAACAACGAGGGACTGGGACTGCTCAACTT
TTCGTTTGACTGGCAATATGTGAGTGGTTTGGATGTAGCTCGATGTACCTTTCCGACTGGACTGCTGACTTTGGTTTTGC
TGCCCAGATCACCTCGTTCAACACGTCGCTCCCCCTGTCGCTGCAGCTGCACTCGCTGGCCGGCTACATTGTGTGCTATG
CCGTGATGCTGGCGATCTACTATTCGAACGCGTGGAACTCGCGGATCCAGCCGTTCATGTCAACGCGGTTGCGCACCGTT
CTCGGTGGCAGCTACCCCGTGTCCAAGGTGTTTGTCAACGGGGTGCTGGACGAGACGGCGCTGGCCAAGTACGGGGTGCC
GCGGCTAGCGGGCTCGTTTGCCTACGCTATGTTCATGGCCAACGCGGCCATCGGCGCGCTGGTGGCACACTGCTTCCTCT
TCTGGGGCGGCGACGTGAAGCGGGCGTTTGCGAGCGCGCGGGCTGGCCGCTACGACGACCCGCATCACACGCACATGACC
AAGCACTACCGCGAGACGCCGTGGTACTGGTACATTGCCGTGCTGGTGATCAGCTTCGTGCTGGGCATCGTCGTGGTCGT
GCACGAGGACATCTCGCTGCCGGTGTGGGCCTACATCGTGTCGCTGCTGCTCGGCTGCTTCATCGCGCCGCTCAGCACGC
TGCTCTATGCGCGCTACGGCAACGGCATCGCGACCAATAACCTGTCCAAGATGATTGCCGGTCTGGCCATCCCCGGCCGT
CCGGTCGGCAACATGTACTTTGCCGCCTGGTCGCACAACGTGATCGTCAACACGGTCAACCTGTCCAACGACCTGAAGCT
GGGCGAGTACCTCAAGATCCCGCCACGCACCATGTTCCTGACCCAGATCTACGGCACCGTCCTCGGTGGTTTCATCAATT
ACGCCGTCATGATCTCCATCGTCAACGGTCACCGCGATCTGCTCGTCAACAGCAACGGTAGCTCGTCCTGGAGCGGCGCC
ACCATCCAGTCCTACAATACCAACGCCGCCTCCTGGGCCATGGCCAAGTACCTCTACAAGACTGGTGCGCCGTATGCCAT
GGTGCCCATCGGCCTGGCCATTGGCGCCGGCGTCGTCGTCCTGCATCGGGTCGTCGTCCGGGTGAGTCTTTCTTCTCTGT
CTCTTGTTTTTATTTTTCGCTCTGTCCTGCTGACACATGCCGCCAGTTCGTTCCCAAGATCCGCGGCCTGGACCTCAGGG
ACATCAACATGCCCCAGTTCATCCAGTTCGCCGGCTTTATTCCATACAACGCGTCGCAGACCTGCGTCATCTGGAGCCAG
CTGATTGCCGGCTTCTTCGTGCAACTCTACCTGCGCCGCTACAAACCGGCCATCTTCAAGAATTACGTGTACCTGGTCAC
CGGTGCCTTTGACGGTGCCGCGCTGTTTGTGCTCTTCATCCTATCGTTTGCCGTCTTCGGCGCCGGTGGTCCGTCCAAGC
CGTTCCCAACCTGGTGGGGCAACAACGCGAACGGCTATTACGACCTCTGCCCGTCGAGCTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62