GenePrediction:GLEAN_6977 Details

Name: GLEAN_6977
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:498696..497969 (- strand)
Length: 728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:498696..498486 (- strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_108:498435..497969 (- strand)
Length: 467
>GLEAN_6977 class=GenePrediction position=GCSC_108:498696..497969 (- strand)
ATGGACGAGGACAAAGAGTGCCTACTGGAGCAGATCCACGGCTCAAAATTGCTAAGGCAAAACCGACGTGGTCGTTGGCT
GACGGCCGGCCGCGTCTTCTTCTTCTTCAACATCCTCTTCCTTGCTGCAGGACTGGGTGTTTGGGTCCACATCAACATGC
TTCTCAAGAAGTTTACGTGCGACACGAAGACCGCCAAGTTCGAGCCTGATTGTATGGACTTGATTTTCCCACACAATCTC
TCTTCAGTTCTAACATCTCAGTGGCCTATGATACTCCGGTGACCTTTGAGACCTATGCCGTCTATGGCGCCCAGTCGACA
AATGTCACTGACAGCATGTGGAAGCGGCTGAGTCCCCCCGGGGATGGCATTGTTCAAATCCCCAACGAATACACAGCAGG
CCTTCGGCCGTCCCGTCCGGCACCGCACAACCCCGAAACCCACACAGTCTACGGCATCTCTATGTTCCACCAACTACACT
GCCTCAACTTCCTGCACTCCGCCTTCACCCCCGAGGCTGTAGCACATCTGACTCCCGATCAGATCGTTCTGCACCGTGAC
CACTGCCTGGACTTTATTCGTCAGGGTATCATGTGTGCCGGTGATTCTACTTTCGAGCCGGTGACGAAGACGGGCATCAA
TGGCATGGGCGTAACGCACAAGTGCCGCAGCTTTGACAAGATGTACAGCTGGGCCTATAAGCACCGCTCGGACAAGCCAA
CTAGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62