GenePrediction:GLEAN_6979 Details

Name: GLEAN_6979
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:490485..489301 (- strand)
Length: 1185
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:490485..490473 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_108:490347..490166 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_108:490080..489301 (- strand)
Length: 780
>GLEAN_6979 class=GenePrediction position=GCSC_108:490485..489301 (- strand)
ATGAAGCTGCTCTGTAAGTGAGCTCACAGAAAGCTTATTGTCTACCGCGCTCTAGCAGTCGGTCCAGAACGAAGGACACA
ATGGGTAAATGACCCTCTTCTTCGTAGCCTCAGGCGCTGATCTGATTTTCCTCAATAGACACAAAACCCGTCCTTGCGGA
TGTGGCCTCCAAGACGATAGAGTCGTCGACCCTGGGCTTCACATCCCTGGCTGTTCTCAGCACTGTCCTGCTTGTCTCGA
TCGGGACAGGAGCTGGCCTGCTGCTGGTCTCGCCGGCCATCACAGCTTCTATCGTGACTGTACTCTTGACATTCTTGACG
GTATGTTTATCTGTCTTTTTGGGGGTTTTTGTCATCAGTTTCTTTCGCATTTTACTCTCGTTTCCTCCTCCCACTGACCA
GTCAGATCCGACATTTCTTCTTTCGCCGGCGCGGGCGCTCGGCCATGGACCAGGCCTGGACGGCGGCCCGGCGTGGCGGC
GTGCCCGATGCCCTCCAGCTACCCAGCACCTACTTCCTCTACGTCCTCGGCTCGGGCGGCCACACCGGCGAGCTCTGCGA
GATGGTCAAGCAGCAGTTCCGCCCGAATCCGCGGTCCCATCGCCGCTACCTCATCACCTCGGGTGACCAGCACTCGGAGC
ACGCCGTGGCCCAGCTCGAGGGCCGCATCCAGCAGGCCTTTCCGTCGGCCGACGACGGTGGCATCGGCCCTGCCGGCACC
TGGGACGTCTTCCGTGTCGTCCGCGCCCGCAGCGTCCACCAGCCGCTCTGGTCCACCGGCTACACCACCGTGCTGAGCGC
GCTCTCGGTCGTGCAGGCGCTCGTGCGGCGGTCACGTGACCGTCTGACCGTCCGGGACGCGGCGGACTTCAACCTCCCCC
ACCTGATCGTCACCAACGGCCCCGGCACCGGCTTCGTCGTCTGCCTCGTGGCCCACATCTTGAAGCTGCTCGGCCTCGTG
CCGGCCAGCCGGTGCGCCGTCCTGTACATCGAGACGTGGGCGCACGTCAGCACGCTCAGCCTGACCGGCAAGCTGTTCTA
CCACAGCGGCATCGCGGACATGTACGTGGTGCAGCACGAGGCCCTGGCTGCCCGGACGGGCCAGCGGTTCGTCGGCGACG
TCGCCAAGCACGGGAACCTGCTGGGCATCAAGAAGACGCTGCGGACGACCAGACAGCCGCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62