GenePrediction:GLEAN_6981 Details

Name: GLEAN_6981
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:484830..481369 (- strand)
Length: 3462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:484830..481610 (- strand)
Length: 3221
Type: CDS
Source: GLEAN
Position: GCSC_108:481549..481369 (- strand)
Length: 181
>GLEAN_6981 class=GenePrediction position=GCSC_108:484830..481369 (- strand)
ATGAACACGGACGAGCTGTTTGAGGTTTTCGACGAGCCTCAGCCGCCGCGGCAGCGGCAGCTGCAGGAGCCCCAGCCGAC
GACGGGGCAGGAAGGTGCGCTCTCGGCCATCGATTTGAGCCGGAAGCGCAAGGCTGAGGGCATGTCGGACGACGACATGG
AATTTGATGGCAGCGACAAGGAGGCGACTGCCCATACGGCCGCCACCAAGGACGACGATGAGGCGATGGAGGACGAGACG
GCCACGGCCGAGACCAATGACAACAAGCGGCGGAAGAAGGAGGACGAGGCTGAGCCGGTGCTGACTGACACCTTCCAGAC
GGCCGAGTCTCGCGAGGTGGCCTCGGCGTCGGGCTTCACGGCCCAGACCGAGACCGAGGCTCTCGTGCTGAAGCACAACA
TCCAGCACCAGGTAGCCCTGCCGCCGGACCTCAACTACGAGTACATCCCGCTGTCGGAGCACAAGCCACCGGCCGAGCCA
GCCCGCGTCTACCCCTTTCCGCTGGACCCGTTCCAGAGCCTGTCGATCGCGTCGATCGAGCGCGAAGAGAGCGTGCTCGT
ATCGGCCCACACCAGTGCGGGCAAGACGGTCGTGGCCGAATACGCCATTGCCCAGTGCTTCAAGCGGAACCAGCGGGTCA
TCTACACGAGCCCCATCAAGGCCCTGAGCAACCAGAAGTTCCGCGACTTCCAGGCCGAGTTTGGCGACGTCGGCCTGATG
ACCGGCGACGTCACCATCAACCCGACGGCCAGCTGTCTGGTCATGACGACGGAGATTCTGCGGTCGATGCTGTACCGCGG
CTCCGAGATCATGCGCGAGGTGGCCTGGGTCGTGTTTGACGAGATCCATTACCTGCGCGACAAGTCGCGTGGTGTCGTCT
GGGAGGAGACCATCATCCTGCTGCCCGACAAGGTGCACTACGTCTTCCTCTCTGCCACGATCCCGAACGCCTTCCAGTTT
GCCGAGTGGATTGCCAAGATCCACCGCCAGGCCTGCCACGTCGTCTACACCGACTTCCGGCCCACGCCGCTGCAAAACTA
CTGCTTCCCGGCCGGCGGCAACGGCATCCTGCTGGTGGTCGACGAGCGTGGCGTCTTTAAGGAGAAGAACTTCAACATGG
CCATGGCGCTGGTCGAGCAGAACAAGGGCGCCGACCCAGCCGACATCAACGCCAAGATGAAGGGCCACGGCAAGAACAAG
AAGACAAACAAGGGCGGTGGTAGCGGCGGCAACGAGTCCTCGTCGGACATTTACAAGATCATCCGCATGATCATGAAGAA
GAACTTTCACCCCGTCATCGTGTTCAACTTTAGCAAGCGCGAGTGCGAGATGCTCGCGCTCAAGATCTCGGGCATGAACT
TCAACAACGAGTCAGAGCAGGCCCTGGTGACGCGCGTGTTTGAAAACGCCATCGACACGCTGTCCGAGGCCGACCGGGAG
CTGTCGCAGATCACGCACCTGCTGCCGCTTCTGCGCAAGGGCATCGGCGTCCACCACTCCGGCCTGCTGCCCATCCTCAA
GGAAATCGTCGAGATCCTCTTCCAGGAGAACCTGATCAAAGTGCTCTTTGCCACCGAGACTTTTTCCATCGGGCTCAACA
TGCCGGCCCGCACCGTCGTCTTCACCACGGTGCGCAAATTTGACGGCGTCTCGATGCGGCCGCTGACCTCGTCCGAGTAC
GTGCAGATGTCGGGGCGCGCCGGCCGTCGTGGCCTGGATGACCGCGGCATCGTCATCATGATGCTGGACGACAAGCTCGA
GCCCGAAACGGCCAAGGCGATCGTGGCCGGCAAGCAGGACCGGCTCAACTCGGCCTTCCACCTGGGCTACAACATGATCC
TCAACCTGCAGCGGATCGAGACGGTGTCGCCCGAGTACATGCTGGAGCGGTGCTTCTTCCAGTTCCAGAACGCATCCAGC
GTGCCGCAGCTGGAGAAGGAGCTCCTGGCGCTGCAGCAGGAGCGCGACAGCACCATCATCCCGGACGAGAACACGGTCAA
GGAGTACTACAAGCTGCGGCAGCTGATCGAGGAGTACCGCAAGGACATGGTGCTGGTGATGCAGCACCCGACGTACTGTC
TGCCCTTCCTGCAGCCGGGCCGGCTGGTGCACATCAAGACACCCAACGGCGGCCAGGACTTTGGCTGGGGCGCGGTGCTG
AGCTTCACACAGCGGCGGGCACCGCGGCGCGGCGAGGAGGAGGTGCCAGCGCAGGAGTCGTATAGCGTGGACGTGGCGCT
ATTTGTGTCGGACAGCCGGTCGACGGAGAACGTGGCGCCGGGCTTCCCGGCCGGCGACATGGCTGCGGGCGTGTTCCCGT
GCGCGTCGGCAGCGGACGAGAACGAGAGCTCGGGCAGCGACAAGAACGGCAAAGGCTCGAGCAAGAGCGGCAAGAGCGGC
AAGAGCTCGGCCCACAGCAAGAGCTCAAGCAAGAGCGACGTGCGCGTAGAGATCGTGCCGTGTCTGCTGTCGTGCGTGAC
GGCGATGAGCAAGCTGCGGATCTTCATGCCGGACAACGTGTCGAAAAAGGCCGGGCGGGAGCAGACGGGCAAGGTGATCC
GGGAGGTGGAGCGGCGGTTCCCGGACGGGATCCCGACGCTGGACCCGATCGAGAACATGAAGATCACGGACGAGTCGTTC
AAGAAGCTGATCCGCAAGATCGAGCTGCTGGAGTCGAAGCTGCTGGCGAACCCGCTGCACGGATCGCCGATCCTGCCGGA
GCTGTGGCAAAAGTACGACAGCAAGGTGGCGCTGGGCGAGCGGGTCAAGGAGAAGAAGAAGGCGATTGCCAAGGCACACA
GCATCGCGCAGCTAGACGAGCTCAAGTCGCGCAAGACGGTGCTGCGCCGGCTCGGCTTCATCAACGAGGAGGACGTGGTG
CAGCTGAAGGCGCGCGTGGCCTGCCAGATCTCGTCGACCGAGGGCCACGAGCTGCTGCTGTCGGAGCTGCTGTTCAACCG
GTTTTTCAACGACCTCGCGCCCGAGGTGGTCGCGTCCGTCATGACCTGCTTCCTCTTTGACGAGAAGGTCGAGGCGCCCG
ACCTGAAGGAGAACCTGGCCAAGCCGCTGCGCGAGATCAAGGCGCAGGCCAAAATCATCGCCAAGGTCAGCCAGGAGAGC
AAGCTGGACGTGAACGAGGACGAGTACGTGCAGAGCCTCAAGTGGCAGCTGATGGAGACCGTGCTGTCGTGGGCCAACGG
CGCGTCGTTTGCGGAGATCTGGTGAGTGCACCCAGAAGCCCTGAACGCAATGCAATTGTACATTCTAACTTAACTTTACA
GCAAAATGACAAACGCCTACGAGGGCTCCCTGGTCCGGCTGTTCCGCCGGCTCGAAGAGCTGCTCCGGCAGATGGCCGAG
GCCGGCAAGGTGATGGGCAGCGAGGAGCTGACAAAGAAGTTTGAGCAGAGCCTGGAGAAGATCAAGCGCGGCATCGTGGC
AGCACAGTCTCTGTACCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62