GenePrediction:GLEAN_6982 Details

Name: GLEAN_6982
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:480406..479879 (- strand)
Length: 528
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:480406..480197 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_108:480130..479879 (- strand)
Length: 252
>GLEAN_6982 class=GenePrediction position=GCSC_108:480406..479879 (- strand)
ATGGACTGTCCGCGAGGCAGTGACTACGCATTTGGGCCCCGGATTCGTTCGGAGTGTCGATCTTTTGATTTCACTCTTCA
ATTCGAGGACTCCTTGTTCGGCTGTCTCCCTGCCGCAACTTTCCTCCTCCTTGCAGCTGCAGATGTGATATGGCTGGTCC
GGTCGCCGGTCGCGTATCAGCGGCAAGGTGGAATCGTTAGCCTCAAGCTGGTGTGTGCTAGACATGTTGACCGCGCCCAG
GTAACGGCTCCATCTTTCTGACAATATCTTGTGCAGTGTACCCTGGCCAGCCTGTTGGCGGCACAGCTTGCCCTCCTGGT
CGTCCGCGTCCGCGTGCCCGCCATCTCTTCAGGCGCGTCCCTACCTGCGGACATTTTGGCGTCTCTGGCTGTTTTGGCAG
CAACGACACTCTTGGTGCTGTACCAGCAGCGAGCGTCGCGACCGTCGACAGTGCTCAGCCTCCATCTCTCGGCAACAGTG
CTTCTGGGCGTCGCCCGAGTGCGCACGCTGTGGCTTGTAGCCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62