GenePrediction:GLEAN_6983 Details

Name: GLEAN_6983
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:479821..475181 (- strand)
Length: 4641
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:479821..479616 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_108:479356..479288 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_108:479211..478940 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_108:478875..478642 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_108:478559..478336 (- strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_108:478060..477812 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_108:477760..477595 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_108:477522..477124 (- strand)
Length: 399
Type: CDS
Source: GLEAN
Position: GCSC_108:477077..476954 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_108:476894..476823 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_108:476763..476690 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_108:476523..475181 (- strand)
Length: 1343
>GLEAN_6983 class=GenePrediction position=GCSC_108:479821..475181 (- strand)
ATGGCAGTGCTCGTGTGGGAGTCTATGGGGCTAGACAGCCGCAAGACGTCAGCAGCAGCTGGCATCGTCGCCCTCGAGCA
GCGCAGCAGCTTCTGGTCTCGAACGGCGTACGCCTGGCTGGCGGTCACTTTCTGGCGCGGTCACAAGCGGGTAATATCGG
TCGACGATCTGCCGCCCCTCGATGGACGCCTCGAGAGCTCACGGATGTGCGAACAACTCTCCCGGTCATGGGGAACATGC
GTGTGGTAGCCTGCTCTCCCCAATCTGACCTGAACTCCGTTCTGACGAGTATCTGTGCGTCTGCCTGAAACAGATGACCG
CCACGGCCGCCAGAGCCTTCTCCGGGCGGTCTTTGGCTGCTATTCTGCCTCCTTTCTGTCAGCTGTCATCCCGCGCTTGT
GCCAGACGGGCTTTACGTTTGCGCAGCCTTTTCTAATCACGGCAACTCTCCGCTACGTGGAGCAGCCAGATCGAGATCGA
GATTACGGCCGAGGCCTGGTCGGCGCCTGGGCACTCGTCTACACTGGACTGGCAGTAAGTATGCCTGCATCCCCGACCAG
GATCTCTTACCTCGTTTATCTGATCGTCCCACCCCGGCCTAGGTTTCCAGGTCGGTGTACCAGTATCAGAGCTTCCGCTT
TGTGACCAGGCTCCGCGGCAGCCTCATCGCCCTCGTCTACCAGCAAATGCTTCAGACGCGGGCGGCCAACGTCGGCAGCA
TCACCGGCCTGACACTGATGGGCACAGACGTGGAACGTATTGTGGCTGGCGTGCCATCTCTGCATGAAGCATGGGCATCG
CTCCTTGAAATCGGTCTTGCCTGCTGGCTACTCGAAAGGCAGCTGTCTCTGGCCTGTATAGCACCAATCCTCCTTGTTTC
CGGTGAGCTTATAGTCATGTGTCTAGAGATCTGTATGGTTTGGGTCTGGTCGCTAAGTTGCCATAGTATTCATTGCCGCC
ACATCTCGGGTGTCACTACGGCTGCGGGATACGCAAGTTGCTTGGATCGAGAAGATTCAGGAACGGCTCCGCATCACTGC
GGCCGTTCTTGGTGACATGAAAACCGTCAAGATGCTTGGCATCTCGAGTGTCGTAGTACCTGTCATCCAGGGGCTCCGAA
GAGACGAGATCGACACCTCCCGTCGGTTCAGGAAGAACCTTGTGGTCATGATACTGTTGTGTGCGTCACCTGTGAACGGT
GCTCACACACTATGATGGAGACTTGCTGATATCAGATCTAGCCCTTACCCCGATCAACTTAGCTCCCGTGCTTACCTTTG
CCGTCTACTCTGTTGTTGCCGTGTTCTGGAAGAATGAAACACTCCTGACCACCAAAGCATTTACCTCACTCACGCTCGTC
TCGCTGCTAACGGCTCCCGTCATCAGCTTCATTCAAGGACTGCCAAATGTGGTGCAATGCCTCGGCAACTTTAGCCGCAT
ACAGGAGTTTTGCAATTACGAGACGGGAGGGGATGCTCCTGGAAGTGTAAGAGACGATAGCACCTGTGACCAAGAGCAGC
CAATGGTACTACAGGGCGCTGGTTTTGCATGGAGCAAATACAACATGGAAACCAAAGTTCTGCGGAACATCAATATCAAA
ATTCTGTGTGGAAGACTTACTGCTGTCGTGGGGCCGATCGGCAGTGGAAAATCGAGCCTACTACATGGTCTTCTCGGCGA
GCTGCATGAGGTTCCATCAGCCTCAGAAGCAGATGTCCAGGTAGCAGAGAAGTGCGATCAAGACGGCCCTCAACTTGCCA
GGCCTCTAGCAGCAGTAAGGAGACCTCTCAAAGGAGACCTCTCATGGCCTACTGCGCGCAACAGCCGTGGCTCGAGAACG
GCACAATTCGCCGCAGTATTGTGGGAGCTTCGCCATGGGATAGCAGATGGCATGGGACGGTCTGCACGGCTTGCTGCCTC
GACCCAGATATGCCACAGCTGGAGATGGGCGACCTCACGCATGTGGGCAGTAAAGGTGTAAATCTGAGCGATGGCCAGAA
ACAGCGCATTGTAAGTTCGTCCCTTCTCTTAAAAAGTTACTGAACTGATGAAGCATGGTAGGCTCTTGCTCGGGCTGTCT
ACTCCAGGCGTCGTACGCTACTTCTGGATGACGTCTTCAGCGGAATGGATGCTTACACGGCCGGATTTGTGATAGCCCGC
CTTCTTGGGTGCCATGGGGGACTGCTGCGGAACGAGCAAACGACTGTGATCTTGACAACCCACAGTCGTGCGTATATCCA
CCCAAAGGCATTGACATGGGCTCGGTTACTGATTCGTCTGATAATAGACAAAATTTTAGGGCTCGTAGATGAGGTCATTG
TTCTAGAAGACGGCCAGGTCACGGAAATGGGCAGTCCGACAGCCCTGCTTCAAAACAAAGGCGGGTATCTGAGGAAGATT
GGATTTTCTAAACTAGCCGAAGAAAACGACATGAAGCTGACTGCAGCGAGTCATCCCGGCCCTGCTTCTGGTTCCGTGCC
CAGGGAAGAGATACCAGGCATGGGGACCGTTGGCGATACTGACGCGACTGTTAACCTGGATGACGGCCAAGAGACTGCCA
CGGCCGAGCACACGGATGTCAGACGCAAGAATTGCGAGCTCTCCATCTACACCTATTATCTCAGAAGCTCTGGCTACGTG
GCTGTCGCCCTGTACGCAGCGTCCATGATTTTCTGGATTTTCTGCACGGAATTCTCCAGTAAGTGGGGTATTGAAGAAGA
ACTTCAAAGTCGCTGACGATGAAGCTGTCTGGGTGAGCTGGTGGTCCGCGGCCAACGACCTGCATCCGAACCGGAATCTG
GGCTTGTACATGGGAATTTACGCCATGGTTGGCGTCGTTGGGACTGCTGCCGCATGTTGTGCAGCCTGGTAGGTGTTCTA
ATATTCGACACCCTGGATATATTGTGCTCGAACTTGACAAATCATAGGTTCGCTTATATATCCATCATATCGAACTCAGC
GAGCAAGCTGCACCTGGATCTACTCAAAGCCACCTTCAGGTTGGTGATATAATTCCTCGAGGGACAACTACTAGACGCGT
GCATTAACAGTTTCCCAGGGCCCCGTTTCGCTTCTTTGCCAACACAGACACGGGCGAGCTTCTCAACAGGTGCATCTACG
ATCTACGGCCCTGTACCTTTTATGTGTGTACAACGAAACTGATAGATCCAGGTTTAGCGAAGATATGGAGTTGATTGATA
TGGACTTACCGGGGACGGCGCTGAATTACACTTCAAGTAAGATAGTACGGCCATGTGTGCCTATTACTGGGATGGTAGGC
TGACGAGATTTACTGCAGCTGCCTTGTCCTGCTTCACCCAGGTGGTCCTCCTTGCGATCTACTCACGCTCCCTCGCTGTG
GCCATGCCGTTCGTTGCCGCTTTTCTCTACGCTCTGCAGCGCTTCTATCTGCAGACATCCCGCCAGATGCGGCTGCTCAT
GATCGAGGCCAAAGCGCCCCTGTACACGCAATTTTCCGAGATGGGCACACCGGGAACAACGGCCAGCGAAAGGAGTGGCA
GCACAGCCGGCACCGGCACCGGCACCATCACCATTCGGGCCTTTGGCTGGCAGCGCGCATATGCGGCGCGCGTGGCTGCC
CTCGTCGATCGGTCGCAGCGGCCTGCTTATATCCAGAGTTGCATCCAGCACTGGCTGGACTTTGTATTGACGCTGACCAT
GGCCGTTCTCGTGGTCGTCCTCGTCGCTACCGTCGTCAGCTGGCAGGACCGTCTGGATATCAGCGCCGGCGGCGTCGGCG
TGTCGCTAGTGGTCCTTCTCGGCCTGTCGACCACGCTGACACGACTCATTCGCACGTGGACACGCCTAGAGCCAAGCGTG
GGCGCCGTGGCGCGTGTGAGGCGTTTTGTGACAGAGACAGAAGAGACAGCGGGAGAGGAGGTCCCCGTGTCGGAATTGTC
GCAACCGGTCGGGACGGTCTGCTTCGACGACCTGGTGGCTGCTTATGAGCCCGACGCTGCATCTCCTGTGCTGCAGCACG
TCTCGCTCTCGGTGCCTCCCGGACAGCATCTGGCCATCTGTGGTCGATCTGGCAGCGGCAAGACGTCGCTGGTGATGGCA
CTGCTGCACATGATGGACGTCCGCTCGGGAGGTATTGCCGTCCACGGTCGCGTCAGCGTAGTGTCCCAAGACCCGTTCCT
AGTGCCGGGCACCAGCCTGCGCTTCAATATGGACCCATTGCTGGCGGCCGTGTCGGATGCGCAGATCGTGCGAGTGCTGC
AGCGAGTGGGACTCTGGGAGGTGGTGGAAGGGCAGGGCAGCCGTGGCCGTGGGAGTAGCAGTGGATGCCTCGACCAGAAG
GTGGATGGCCTGGCACTGTCGGCGGGTCAGCGGCAGTTGCTCTGCTTTTCCCGGGCCTTGGTGTATCGGGACCAGACCGA
TGTGCTCGTGCTGGACGAGGCTACGTGCAGCCTCGACAGCTCGGCCGAGGCGGTGGTGCAGCAGATTATCGACACTGACT
TTCGCGGATGCACGGTGTTGGCAGTTATGCATCGTCTGGCGCACGTGGCGTCCTACGACCGGGTGGCCGTTATGGACGCC
GGGGCCCTGGTCGAAGATGGGGCGCCTGGAGAGCTCATCGCCAACGAGAGCTCGCGCTTTGCAGAGCTGTATCTTACATA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62