GenePrediction:GLEAN_6984 Details

Name: GLEAN_6984
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:474291..472356 (- strand)
Length: 1936
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:474291..474267 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_108:474078..474038 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_108:473901..473875 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_108:473797..473722 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_108:473666..473136 (- strand)
Length: 531
Type: CDS
Source: GLEAN
Position: GCSC_108:473067..472644 (- strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_108:472584..472356 (- strand)
Length: 229
>GLEAN_6984 class=GenePrediction position=GCSC_108:474291..472356 (- strand)
ATGCGTGAAATCATTAGCATCAACGGTACGCTACTCGCCCTCCCTGTTCTTTCTTTTTCGTGCTATCGGAGCGCTTCGCT
GGTTCGGCCTGGCGCGTGGCCCTTATGATTGCCGGTAGAATCCTTCACCGCATCGTGGCGCCAAACAGCTCCAGACGACC
ACGGCTGCCCTTGAAACTCGCTGTCTCGGTGTACTGACATTCATCTGCTACAGTCGGCCAGGCTGGCTGCCAGATTGCCA
ACTCCTGCTGGGAGGTATGTTCCACGCAGTTCGAGGAGAAAAATATAATCTTGAAAAGGGGGGATCCAGGAGGAGGGGGG
GGGGGGGTTATCACGATGACGGCGTCTCGATGATCCGGCTTACGACAGCACGCTGACATGACCACAACAGCTGTACTGCC
TCGAGCACGGCATCCAGGTATGTTTTCCCCCGGCAGTCTCCTTATTTTTGATACATATACAGCTCTTCAAGCAGTACTGA
CTATCTGGCTCTAGCCCGATGGCTATCTCACGGAGGAGCGGAAGGCTGCCGATCCAGACCACGGCTTCAGCACCTTTTTC
ACGGAGACTGGTACGTCTGCCACATGCTCGACTTCCCCGTCCATCCCGATGCTGACTTTATACAGGCCAGGGCAAGTATG
TGCCGCGCACTATCTACTGCGATCTCGAGCCCAACGTCGTCGATGAGGTCCGCACCGGTCCCTACCGCAGTCTGTTCCAC
CCGGAGCAGATGATCACCGGCAAGGAGGATGCGTCCAACAACTATGCTCGTGGCCACTACACCGTCGGCAAGGAGCTGAT
CGACCAGGTGCTCGACAAGGTCCGCCGCGTCGCCGACGGCTGCGCCGGTCTCCAGGGCTTCCTGGTCTTCCACTCCTTTG
GCGGTGGTACCGGCTCCGGCTTCGGTGCCCTGCTGATGGAGCGCCTGTCGGTCGACTACGGCAAGAAGAGCAAGCTGGAG
TTCTGTGTGTACCCGGCACCGCAGACCGCTACGTCCGTCGTCGAGCCGTACAACTCCATCCTGACCACCCACACTACCCT
CGAGCATGCCGACTGCTCCTTCATGGTCGACAACGAGGCCATCTACGACATCTGCCGCCGTAACCTCGGCCTGGAGCGGC
CCAACTACGAGAACCTGAACCGTCTGATTGCTCAGGGTACGGCTACTCTTCTCCCGTCCTGCTCCTGCTCTTGCTCTTGC
TTGTTCTTGACTGACCAAATCTAGTCGTCTCGTCCATCACCGCCTCGCTCCGCTTTGACGGCTCGCTCAACGTCGACCTG
AACGAGTTCCAGACGAACCTGGTGCCGTACCCCCGTATCCACTTCCCTCTGGTCGCTTACGCCCCGGTCATCTCGGCGGC
CAAGGCCGCGCACGAGGCCAACTCCGTCCAGGAGATGACCATGTCCTGCTTCGAGCCGAACAACCAGATGGTCAAGTGCG
ACCCCCGCCACGGAAAGTACATGGCCACCTGTCTGCTGTACCGCGGTGATGTCGTGCCGAAGGACGCCCACGCTGCCGTC
GCTACGCTCAAGACCAAGCGCACCATCCAGTTTGTCGACTGGTGCCCGACCGGCTTCAAGCTCGGTATCTGCTTCCAGCC
GCCCGAGATGGTCCCCAACGGCGACCTGGCCAAGGTCAACCGCGCAGTGTACGTGGATAGCATCTCTTCCCTTTCTCTCC
TGTATGTGTATGTTCTAACAAGCCTAGGTGCATGCTTTCCAACACCACTGCGATCGCCGAGGCCTGGTCCGCACTGTCGG
CCAAGTTCGACCTCATGTACTCCAAGCGCGCGTTCGTGCACTGGTACGTCGGCGAGGGTATGGAGGAGGGCGAGTTCTCC
GAGGCCCGCGAGGACCTGGCTGCGCTCGAGCGCGATTACGAGGAGGTCGCCACGGATTCCCTGGAGGGTGAGGAGGGCAC
CGAGGCCGAGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62