GenePrediction:GLEAN_6985 Details

Name: GLEAN_6985
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:471144..466975 (- strand)
Length: 4170
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:471144..471117 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_108:471027..470879 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_108:470817..467071 (- strand)
Length: 3747
Type: CDS
Source: GLEAN
Position: GCSC_108:467004..466975 (- strand)
Length: 30
>GLEAN_6985 class=GenePrediction position=GCSC_108:471144..466975 (- strand)
ATGGTTTCCGACGGCTCCGACGATGCTGGTGAGTGCCGTGGCGAACGAACGGAATGGCAGACGAGAGAAAGGAGAAAAAC
CGAGAAGGTGGCTGACCAGACAAACACGCGCTCCCAGGCCCGAACCTCAATCTCACACCGGATGAGAGGCAGCTGTATGG
CCAGCTGTTCCGTCAGGCCGACACGGAGAGTGTCGGGATTGTGATGGGCGAGGTGGCCGTCAAGTTTTTCGAAAAGACGC
ACCTTGATTCGCGCATACTCGGCGAGGTAAAGCCGACCCCGTCTCGGTCTCGGTCTACCATGTGGCTCGCTCGCTGACAT
GCCACAGATCTGGCAGATTGCCGACTCGGAGAACCGTGGGTTCCTGACGCCGGCGGGCTTTGGCATCGCCCTGCGCCTCA
TTGGCCATGCCCAGGCTGGCCGCGAGCCGGGACCAACGCTGGCGCTGCAACAGGGGCCCCTTCCACGATTTGAGGGCGTG
CCGGCGCCGGTCAGCGCGCTTCCGCTGGTGCAACACACCACAGGCGGCCCCGGGCCTCTCTCGGCCCAGCTGACGGGTGG
GATGCCACAACTGGTGGCACAGGGAACAGGCAGCGCGCGGGTGCCGCCGCTGACGATCGACAAGGCAGCCCAGTACGCCA
AGCTCTTCCGGGAGCAGGTGCAGGGCGGGTCGATTCTAGCGGGCGAGAGGGCGAAGCGGATCTTTGAGCGGTCTGGGCTG
CCCAACGAGGTGCTGGGTCGGATCTGGCAGCTGGCCGACACGGAGCAGCGCGGCGCCTTTGTGCAGACGGAGTTTATCAT
TGCTATGCACCTGCTGACGTCGACGAAGCTGGGCACGCTGCGAGGCCTGCCGTCGGCCCTGCCTGCAGCGCTGTACGAGG
CGGCGACGCGCGGTGCCAACGCGGTGGTGGCGGGCGGCGCTCCGCTGACGAATCCGGCCAGCCCAGTTCGCCAACAGAGT
CCTCTAGGGGGCACGCCTGGGGTGCCGCCTCTTCCGCCTCTTCCGCCCCTTCCGCCTCTTCCGGCATCAGTTCGCCAGAC
GACAGGGCAGTTCCGGCCGGCACTGCCGACAGCACCACCGGCAGCGAGCGACTGGCTGATCACGCCGGCGGAGAAGTCAC
GGATGGACCCCGTATTCGACAGCCTGGACAAGACCAAGAAAGGCTTCATCACGGGCGAGGAGGCGGTGCCATTCCTGACA
CGGTCGGGGCTCAACGAGGACGCACTGGCGCAGATCTGGGACCTGGCTGACGTCAACTCCGAGGGCCGTCTGACGAGCGA
CACCTTTGCAGTGGCCCTGTACCTGATCCAGCAGCAGCGGCAGCGTACTGACGGCGGCAGCGCTCTCCCTACGAAGCTTC
CGACGAATCTGATCCCGCCGAGCATGCGGAGCAGCGCGCTGCGACCGACAAGCCCGGCAGCGATCCAGCAACCGCAGGTG
CTGCAGCCACCACCGCCACCACCGCCGCCACCACAGCACAAGTCGGCCCTGGACGACCTATTCGGGCTGGACTCGGGCCC
GTCGTCACCCGCGGCCACGCCGGCGCTGACAGCCAACGTGACCGGAGCTGGAGCTGGAGTGGGCGGTGCCCTGAGCGATC
CGTTCTCGGGTGGCGGCGGCATGAGCCCTCTTCCACCCAGCTCGCCGTCGAGAAAGTCGCCGGTGCCGGTGACGGCGTCG
TCGTCATTCAAGCCGTTTATTCCGTCGTCGTCGTTTGGCCGAGCACTCACGGCACAGGCGACGGGCGATTCGTCCGGATC
AGCGCCGCCGTCGTTTTCGAAGCCAACTCCGGCCATGGCGCCGACACCTGTGCCACGGCCGTACAGCGCGACACCAGCGG
TGGCACAGGATGATCTGCTGGGCGGCGACAACGACGAGGCCAGCCGGAACATCTCCAGCGACACGGCGGAGCTGGCAAAC
CTGTCAAACCAGGTGGGCTCGCTGTCGAAGCACATGCAGGAGGTGCAGACGCACCGGACGACGCTGCAGGCGGACCTGGC
GCAGTCGAGCCAGCAGAAAAAGACGTTTGAGCAGCGGCTGGCACAGCTGCGCAGTCTATACGAAAAGGAGGCGCAGGACG
TGCGGGGCCTAGAGGAGCAGCTGACGATCGCACGGTCGGAGGCGAAGAAGCTGCAGGCGGAGCTGTCGACGCTGGAGGCA
TCGTTGCAGGAGATGCAGAGCCAGCACCAGCAGGTGTACTCGGCGCTGCAGGCGGACCAGCAGGAGAACGGCAGCCTCAA
GGGCCGGATCGCGACGGTGACGGCCGAGGTGAGCCAGCTGAAGCCGCAGATCGAGAAGCTCAAGTCGGAGGCGCGGCAGC
AAAAGGGCATCGTGGCGATCAACCGGAAGCAGCTGTCGCTGGCGGAGAGTGAGCGCGAGAAGCTCAAGACGGAGGCGGAG
GATCTGACGCGGCAGAACGAGGAACTGTCTCGGCAGATCCAGGCGACGTCAAATGCGCCGTCGACGACGGCCAGCCCCTC
GGTGGCGTCCAGCACGGGCAAAAACCCGTTCTTCCGCCGGACCGGCAGCACGGACGTCGTGGGCATGTTCGGGTCGCCGC
GGGCGCAGTCGGAGTCACCGAAGCCTTTCAGCGGTGAGCGCTCGTTTGACGATGTGTTTGGGCCGCCGCCGACGGTCGCT
GCCACGACGAAAACGGCCGCTGCAACAGCTGCTGATGCCGCTAGCCCCGGCGCCGTTCAGCCGCAGACAATGGGCGCGTC
CTCGGGCAGCGGAGCCTCGTCGACCTTTACGGCGACCACGGCTCTCAGCGGGCCGACATCTGCCACGCCCACGGCAGCGG
CCAGCGGCCAGGCCACGTTTACCGGCGAGGCAACGGAGGGATTACCAGCCTCTGAGGCACCGACGACCGAAGCACGGCAG
AACGGCGAGGGTCCGGTCGGATTTGCGACCTTTGGAAACAGCGTGCCCGAGTCTACGACTGCAGAGACAAAAGAGGCCAA
CGTCTGGGGCCACGCGCACAACGACAGCCTCACCGACCCGTTTTCCGCGCTGGACAGGCAACAGGACAGCAAGGCCAAGG
AAGACTTCGAGTCGGCCTTTGCCAGCTTCAAGGCGAGCAAGGCATCGGCCGACGAGACCGACGCCGTCTTTGCGCTTCCA
ACCGACGGCACGGTCACGCCGCCGACAGCTACGACGACGACGACGACGGCGACGACGACGGCGACAGCGACGACAGAAGC
AGCAGTGACAACGGCAGCGACAACGATGGCCGGCAGCGACGCCGTGCACGCGGACGCGGCCAAGGCGAGCACGGCCTTTG
ACAGCGAGTTTCCGCCCATTGCTGAGGTGACGCGGGACGACGATTCAGAGAGCGAGAGCGAGAGCGGTGGCTTCGGTGGC
GGTGGCTTTGACGACGACTTTGCGCCGGCATCACCTCCGAAAGCGAACGAGGACAAGGCCGACAAGGGCGACAAAGGCGT
GGCGGAGGCAAAGGCAGTTGATGCTAGCAGTAACATGGACGGCCTTTTCGCGAGCCCATCTGCTCCGTCTGCTCCTTCTG
CTCCGGCAGCAGCGGCAACAGCGGCAACAGTGGCAACAGTGGCAACAGTCGAGGCCGAGCCGTCGTTTGACGACCTGGAC
GACGAGTTTGAGGGGCTCGAGGACGCGCGCGAAGAGTCGGCCGACGACGACTTTGCCAACATCAGCCAGACGACCAACAC
GTTCCCGTCAGCCTTTGACTCGCCACAGCAGTCGCAGCCGCAGCAGCAGCAGCCGGGAAAGCTGGACTCGACGGCGTCTA
GCTTTGGCCTCGACAGCAGCTTCGACTTTGGCAGCCTGGGCTCGTCGGGCCAGACGGCCGCCGCGACGACGACGACGACG
AGCGACAGCAACGACTGGTTCACGTCCTTTACCGAGGCGCCGGCCAAAGAGGACAAGACAGCCGGCTCGGCTGTCCCTGG
TCCCGAGACGCTGGCCCGGCCTCCGGGTCCTGGCCGGCTCCTGACTGACGACGGCGAGCACGATGACCCCTTTCTCAAGA
AACTAACGTCCATGGGCTACCCACGGATACAGGCGCTGAACGCGCTCGAGAAATACGACTACAACGTTGACAGAGTATGT
TTGTGGTTGTTTTTTCCTTTCCTTCTTTTCCCCATCTTCGACTTCCACTAACATATGCAGGCCGCCAACTTTCTCGCCAG
CCAGTCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62