GenePrediction:GLEAN_6986 Details

Name: GLEAN_6986
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:465536..464517 (- strand)
Length: 1020
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:465536..465236 (- strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_108:464776..464517 (- strand)
Length: 260
>GLEAN_6986 class=GenePrediction position=GCSC_108:465536..464517 (- strand)
ATGACTAGTGGTCCAGAAGGATCGACGGACCTCCGCATTTTCGTGCTGCACCGCTGCTGCACCCTCCAGGCGGCTGAAAA
GGCCCGGTCTGTGGTACAGACAAGGGATGAACAGTCGGTGCTGGACCGGGGCCGCTCGGAATCGTTGTCGTGCGTCGTGC
GTCGTGCGTCGTGCGTCGTGCGTCGTGCGTCGTGCGTCGTGCATCAGATGCTGTTTGTATGTCGACAAACCGACGTCGGC
CAACTGCCAGCTCTGATCTCGGCGACGCCTTGGGTTTGTGACAAATGTCGCCTGCGATTGCGTCAGTGTCGATGCTTCTG
CAGCGCGTCGCCAGTCGGCACTTGTCGTTTTGTTATCGAAAGAATGAGTAACCGGCCGTGAAGAGAATCGATCAGCAGCT
TTCAGCTCGTGCTGCATAGCCTACTTGCTCGCGCTGGTTTAGGGAAGGTATGCGTGTGGTGTTCCTTCCCTCCCCTTTTC
CGTGCTTCCCCTTTCCGTCCTGGTCTCGGGGTTTGGTGGTGTTTTCTGCGTCTTCGACGGATAGTCTGTTTTTGCCTCCT
TCCCCCTGCTTTCTTTCCGCTTCGTATCTTCTTGCTTCGGTCGAGTCGAGATCTCGCCCTGGGATCGTCCCGCGCTCCCC
AGAATTCTGCTGCGGCTGTCCACGGGCGCCTTGGTAGCCTCTCTCGGAAGCTTATGCAGGATCAGTCCCCCAGTATTGCA
TGAACAAGTCAATATTGTCATGGGCTAACGATGCAACTAGCGAAACGCCAGCACAGCGACGGCACCATGAACTCGCGGGA
AAAGTACAGGTACTTTCCTTCGAGCACTGTCAGCTCGCCTTTGTCTGGCTGGACGCGGCTGGAGTCAGTTGCCTGCTGGT
CCGGGCTCACGTCTCGTCACATCTGCCTGGCTTTGCCTTTTGCCTTTTCACGTCTCTGCTCCAGCCAGCAGTCAGTCAGT
CAGCCAGCCGTCAACGTGCACGCTCCGACGCTCCGCTTGGACTCGCCAACCAACAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62