GenePrediction:GLEAN_6987 Details

Name: GLEAN_6987
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:464229..462153 (- strand)
Length: 2077
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:464229..464158 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_108:464095..463202 (- strand)
Length: 894
Type: CDS
Source: GLEAN
Position: GCSC_108:462495..462268 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_108:462215..462153 (- strand)
Length: 63
>GLEAN_6987 class=GenePrediction position=GCSC_108:464229..462153 (- strand)
ATGAAAACTGTCATTTACGCCTCTTCCCTGGCCGGCCTGGCCGGGCTTGCTGCTGCCAATGCGTGCGAACCGGTATGAAT
GTTTGCATTCCTTCGCTGTCCATCGTCTCGATCAGAACTGACAGACGTCCACAGAACAACTGTCTGCGTGCCATCACGGG
CACGGCGGGCGGCTCAGCCAGCCTATCGCAGCACAAGTCGGACTGCAGTTCCTTCTTCAGCTTCACGGTGCCGGCGGCCG
AGGCCACAGTGACGGTAACGTCGACCTGCACGGCGACAGACTGGGCCACGACCACGGTGGAAGCCGGCAGCGGGGTGTCG
GTGCCGGGCTCCACGGAGACGGTGTCGGTGACTTCGACGCTGGCCACAGTCACAGATACGACCACGATCATCGGCAGCAC
CGACACCGTCCTGGTGACGCAGGGCGCGACGGTGACCGTGCCGGTGACCGTGACCGTGGACACAGCCACAGTTGTGCTCA
CAGACACGAGCACAGCCACAGAGACGGACACCGCCACATGGACGGACACCGCGTTCGTCACAGACACAGACACAATCACA
GCCACGGCCCAGGAGACGGCCACGGCCACGGTGACCAACAAGTGCCCCACGACGACGAAGTGCGTGACCAAGGGCTACGG
CCATGGCGGCTACGGTGGCGGTGGCTGGCGGCGCGGTCGCTTTGCACGTGACGCAGCGAATGCGGCCGGTCTGCTGGCTG
TGCGCGCCGACGCCTACGGCGTGACATCGCCGACGGACATCCCGACGTACGCCGGCGCCTGCAACAGCACTGCTGAGTAC
TCAAGCGCCTGCTCGTGCTTTGGTGTGACCAAGACGACCGTCACGCAAGGCTACCCAACCGGCACTGTCACGGTGACGAC
GACGGCCGATGCCACGGTCACGGTGACGTCGACGACGACTGTGACAACGTCGGCACCCGTCGTGACCGGTCCGGCCGTCA
CGGAGACAGCTACGGTCAGCGCTACGGCCACGTCGCTCGGCACCGAGACGATCGACGCGACGACGACGGTCTACGGGTGC
AGGGCCCCACGGCCACGGACACGGCCACGGTCACTGTCGATGATGCCATCACGACGACGACCACGGTGGCCGTCACGGAG
ACTGACACTGTCACGGTCAACGTCACCATCACGGCCACGAGCGACATCACCGTGACCGACACGACCACCGACACGGCCAC
GACCACGGCCACCGTTGGCTGCAGCTCTACGCTCACCATCACCACGACGTCCATCACCGGCTACCCGACCAAGACCAAAT
ACCCGACCACGACCGGCTACCCTACCACCACGTCCAGCTCGGCGTGGTCCTACCCCACATGGCCCAAAAAGGGTGGATGG
AAGAAGCGGTCTGGTTTCTTTGGTCTTGCATGAAAGTATAGTCTAGAATATGCTTGGGCTGGAGAAAATGTGGTGTAGCA
CACAGTGGGCTGCGAGGAGGTGCTGGAAATGAAATAGGTATAGATACAGGCGAGACATGTAGTCTGCCCTGTTTCTGCTT
CAATTTCATGTATCGGTACAATGGGACTATTGAATCAGACCAAGTAAATGGCTGCGAAACGAGAGAGGAAGTTGCTGTGC
GTGCAGGTGTTGTGGTTGCTCCACCTAGCGTATTACTGTTTTGGGATGTTAGTCAACCGATTTTTCCCCGCGATTTTCCA
GTGGCAAAGAGGGCTTTTTTATTTTTTGTAGCTTCAACTTTCACTTTTGCCCAGACGTCGACCGACCGGACTGCCGCGAC
CATGAGCGAAGACGAAGACGTTGCCATCTACGACGAGGTCGAGATTGAGGACATGACGTATGATGCAGCGCGGGGCCTGT
ACAACTACCCGTGTCCCTGTGGCGACCGGTTTGAGATCGCGCTGGCAGATCTGCTGGACGGGTCCAGCGACATTGCCGTG
TGTCCGAGCTGCAGCCTGATGATCCGGGTGATTTACGATATGGTATGTGGTTGTTTTGCTGTTGGCAGCAGAGCGTGCGC
TGACACGATGCTAGGAGGATCTGCCAAAGGGACCGGGAGACGTGCCCCAAAGCGAGGCCGTGGCCACGGCAGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62