GenePrediction:GLEAN_6988 Details

Name: GLEAN_6988
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:459297..458671 (- strand)
Length: 627
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:459297..459003 (- strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_108:458947..458886 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_108:458790..458671 (- strand)
Length: 120
>GLEAN_6988 class=GenePrediction position=GCSC_108:459297..458671 (- strand)
ATGCAGAACACCATCTTCCGCCAGCTAGCTGCCCGTCTGCGGCCGCGAGCCCTGCCGACACACGCCTTTGCTGCCGGCTC
GCCAGCTATCTGCGCCGTCCGCCGTATCTCCTCCTCTCCTCTGGCCGGCCCGCGCGCCTACAAGACCAAAAAGGTCTGGC
CGCCCGACTTCAACCTGCTGTCGCCACAGGAGCAGCTGCGCTTCGAGAAGCGCTTCAAGCGGCGCATGGCGCTGCGGGCA
GAACGGCCGCGCTGGATCAAGTTTGTCAAGCTCGCACAGCTGTTCACAATCACCAGTATGTTCGTGCGAGAGGGGAAGAG
ACGGGATGAAAAAGAAGCTAACTGCAGCAGCCGTGCTCATCTATTGCGTTTTGTTCATGGAGTGGGATCGCGGCCCAACA
CCGTTTGACGATGTATGTCTTTCTCATTACGCCTTCTTTCTCCCTCTTCCGTGCCCGTGTTTGTTCTATATCCAATCATA
TCCCATTGTTCTGTGCTGACAAGGCAGCTACGTGCCTGGTTCTGGGACGTTCTGGGGACTCGGCAGGGCGGAGCACTGCA
GCGCGGAAAAGACTCGGATAGCAGGAGTAGTGGTGCGGCAGCCGAGCCGCGGACGGAGACGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62