GenePrediction:GLEAN_6990 Details

Name: GLEAN_6990
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:452623..452061 (- strand)
Length: 563
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:452623..452561 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_108:452216..452061 (- strand)
Length: 156
>GLEAN_6990 class=GenePrediction position=GCSC_108:452623..452061 (- strand)
ATGCGCAAGAAGCGGGCTAACGGCTCCTTGTCGCCTCTCTCTATCTTCCTCTCATCCTACTATGTAAGAGGACACATAAC
GCCAAGACACCCCCCCTGATCGTACTCCGTACACATAGTGTAGCTTCGGGCATACTAGTGGACGTACTATATATCGTGTC
TCTGACCTGTAATATACGATATTATTTGCCCAAATAAGATAAGCTGATAATGAATCCCGCTGTCAGATTGTAGTGGCTTG
TCGCGATCCATATCCTGCCTTTGTTGGCGCTGTCTCGAATCGTTCGTCGTCTCGGGGCATTGCAGAGCGACCTTTTACAA
GCCTCCAGATATGCCGGTTCGAATGCCCGACTTTGCGCTCAATCCCCTCCCCCACAGCACTGCACTATTGCGTTATCCCT
TTTGTAGATTAGCGTGCTTTCGCTGGCCCCGTCGGTCTCTGAGGGCGCTATCGCTGTCCGCGTAAAGTCCGTCCTGCAGT
CACACTCCGCCAAGCCGAATTATACTGGAGAGAGTGCGTTCCTTGTCGCCGAGCGCGTTGGGAAGCAGGAGGCGTGCGAG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62