GenePrediction:GLEAN_6991 Details

Name: GLEAN_6991
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:451185..447823 (- strand)
Length: 3363
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:451185..451167 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_108:451107..449446 (- strand)
Length: 1662
Type: CDS
Source: GLEAN
Position: GCSC_108:449387..448726 (- strand)
Length: 662
Type: CDS
Source: GLEAN
Position: GCSC_108:447984..447823 (- strand)
Length: 162
>GLEAN_6991 class=GenePrediction position=GCSC_108:451185..447823 (- strand)
ATGCCGACTCAATCAACCGGTTTGTCCTGCCAGGGCCGATGAGGTGCTGTAGAGACGGCGCAGCTGACCAGGATGTAGTT
GATTCCCCTGCAGACTTCAAGGAAGAGTCCATGGCCGACCACATGGCCGACCACGCGTCCTTGGCAGACAATCTCTTCGA
ATCCCTTCAGAATGCGCTGAAGCGACAATGGTCCGACGAACCCGACATGGGGGCCGATGGCTGCCAGACAGATGCCAAGC
GGATCAAGGACGAGCCACAGGACGATCTGCTGGACGAGCCCGGCTGGGACATTGGCGCCCTGCTGGAGTCTGCGCTCGGC
TCCATGGACCAGCTGGCTGGGGCCCCCATGGCGGCCTCGATCGGCAACCAGGTCGGACTCGGCACGGCCGACGTGTCGGC
CATGTCTCAGATGGACATGTCCCCAGTGGTCACGACGGCCGAGCAGAGGGGTGTCACGAAGCCGGGGGTGCCTGCGTCGG
CGGCCAGCGACAGCCACACGGCCGGCGCATCGTCGCGGGAGCAGAACAAGATGCGCTTCTCCCAGAACCCCACCTACATC
GTGCGGTCTATGGGACTGTCCATGCTGGGAAGTCTGGCCGTCCAGATCCTGCACGCGCTGAGCGAGCGGCCCCGGCCCGA
GGGCCTGAGCAACCTCACGTCGGCCGACACCGAGACCGGCCGGTGCTACAGGGCTCTACGGGCCACCTTTTGCTGCGCAC
GCAAGATGTTCTCCGACTCATCGGCCCTGCTGATCCCCGAGGAGCTGGACATCAAGGAGCTCGGTGACCAGGAAACCATT
CAGATGGCCAACATGGCGACGATCTGTGCCAGCGTCTTCGATGCCGACGACGTGTCCCTGATCGACATGCACGACCACTT
CTTGATGACGTTTCTGCCCGAGTCCAACGCGCTGACCGAGGATCTCGCCACGCTCTTTCTCGGCCTCAAGTTCCGCACCA
TCGCCGGCGAGTTCCAGCGGCTGCCTGACGACCAGCAGCGAGGCGATTTTCTGGAGCGGCTCTTTCCCGCCGACCTCGAA
GACCAGCTCAAGCAGCTGCATCCAGACGTGCCGCTGTCGGATCAGGAGCTCGCCTTTCTCAGGGAAATGATGGCAGCAAA
AGACTTGCTTCTTGAGGCAGCAAAGACGGAGCAGTCGAGGAGTACGCATCTCCATAGCCCTCTTTTCCTTTGGCTGCCTA
GACTAACCGTGACCGCAGATGAACTGACGGAGAAATACCCGCTGGACTCGTTCCGCAACGAGCTCAGCGCCTTCTTGGAA
ACCAACGCGGACATTGTGCTAAAGTATGCAGAGACGCACAGCATTGAGATTCCGACAGAGGAAGAGTCTGTGTCGGACGA
GCAAGCTATGAGCGATGCTCTTGCCGAAGTGAGTGCAAACCTCGCATCCATGTTCGCAATGGAGACGGATCCGCCAGCCG
AGGCCGCGCCACCTGCGCCACAGACAGCTGGCATCACGGCTGTGCACGGCGGCGACATGGTAGACGCTATAGAGTCCACG
TCCATGAGCGAAGGACTGAGCAAGTTCATCCAGGAAGCAGTGCAGAAGAGCGCGTCTGCCGCGCAGACGAACACGCAGAC
GGCGACTGAGAACGGCACGTCTGGATCCACAGGCGAAGCAGACCTCAGTGGTCTGACCATGCTCTTGAGAGAGAAGCTGA
ACCAGGAGACGCAAAACGCGCAGGCTGCCCAGACGCATTCTCCCGTAACGGCAGCTAATGGTATGTAGTCCCTCTCTCAC
CGACATTCCCCCCTCTTGCTGACAGCCGGGCACGGTAGCCGCCCTTACGAGTATGCAGAACACGTATGCGAACCAGCTGG
CTCTCTTCCAGAGTCGGACTCCTTCGTTTACTCGGCAGCCGATACAGCCGCCCGTAACCGAGACACCTGGTGGGGCAAAC
GGGTCGCTTCCACCCAATCAGACGTCGCCTAGCGCCGTCCTTTATCAAAGAGCGCGGCAGGCCGCGGCAGCAAAGACGAC
TGCGCACGCCCGAAGGGAGGGCTTGCATAGTACGCGGCGGCCGTGGACACCCGACGAGGAGCAGGCCCTCATGGCCGGGC
TCGACATGGTCAAGGGACCGCACTGGTCGCAGATCCTGCAGCTGTTCGGCGCCAACGGCACGATATCCGACATTCTCAAG
GACCGCAGCCAAGTCCAGCTCAAGGACAAGGCCCGCAACCTGAAGCTCTTTTTTCTCAAGACGAACTCGGAGATGCCCTA
CTACCTCCACTGCGTCACCGGCGAGCTCAAGACGCGGGCGCCCGGCCAGGCTGCCCGGAAAGAGGCCGAGGAGCGGGCGC
GGTCCAACAACGAGGAGGAGCAGGCCCGCGTGCGCGGCATCATGACGCTTGCCGGCGGCCTGCAGGACAACAAGACCGGT
GCAGCCACGGCGACAGACCTGGGAACGGCACGGACGACGGGCGCAGCGCGGGCTCAACCCGTTCCACAGCAACAGCAACC
GCAGCAGCTGCAGCAGCAGCAACAACAGCAACAACAGCTGCAGCAGCGGCTTCAGCAACAGCTGCAGCAACAACAACTCC
AGCAGCAGCAACAACGACCACAGTCAGCAACGACAGGAGCTGGCAGACCAATGGCGACGGCAGCCTCACAGCTGCCAGCG
GTACAGGCCGCCCTCGACTCGATCCGGAATATCGTTCCCCTTAGTGGAATGCCGTCAGAAACACCACAAGGGTCTGGACG
GCCAGGACCTTTCAGTCGTGCTGCCACGCCATCAAACTCCGAGGCAGGCAATGCTACAAGGCCGATCACAGCCGGCCTCC
CAGCTGCTGGAGCCCCGGGCGTCACCACTCCTGGCGGACTACAGCGTCTACAACAACACCAACAACAGCAAGCCCGTCCT
CCGATGTCGCCACAGCCGATGGCCCAGAGCGCAAACCAGGCGAGGCCTCTTCACCAGCAGCAGGCGCAGCAACAGGGACA
GGCCAGGCCGGCAGTCCAGCAGCAGGCGCAGCCAAGCCAGATGCAGCCTCAACATCCACTGCACCAGTTGCAGCAGCAGC
TCCAACAACAGCAACAACAACACCAACAACAACAACAGCAGCAGCAGCAAACGCAACAACCAGCGTCACCACATCTCCCC
TCGCCACCCCAGACCTACTCTCCCAGCCAAGCACAACAATTTCACCAGTTGCACCAGCTGCAGCAGCTACAACAGCCTCA
GGCTGAACCACAGGCTGAACAGAATCACAACGGCTCGACAGAGGACTCTGCCTCGGCCCAGCACATGCTTCATGAGCCTG
TAGGGCAAGCAGAGGCCGAACCCCAGTCTCCCAAGCAGGAAAGCCTCGAAGAGGCCATAATGAGGCTCAAGGAACTGGAA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62