GenePrediction:GLEAN_6993 Details

Name: GLEAN_6993
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:443752..443261 (- strand)
Length: 492
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:443752..443538 (- strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_108:443482..443398 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_108:443332..443261 (- strand)
Length: 72
>GLEAN_6993 class=GenePrediction position=GCSC_108:443752..443261 (- strand)
ATGCCGCTCCAGAACTCCGTGCTCTCGCCGGCGGCGCTCGCGCAGCAGCTTGTCAAGGACGCCAAGGCCGGATCGACACC
GGCGTATCTCGTCGTCTATGCCGGCCTCATCAACGGTCGCAGCTGGTGCGGCGACTGCCGGACGGCCGAGCCCTATCTGG
AAAGGAAATTTGCCCAGAAGGACGCTCAGGTGGTCTACGCAGGCGACCCGCAGAAGTGAGCCAGACGCCTGTCTCCCCTC
CGTCTGATTTCTGACTCTGAACCTGTGCAGATGGAGACGGACAGACAATCCGTTTCGCCAAGGCCCGTTCAACGTGACCA
ACCTGCCGACGCTGCTCAAGGTGACCAGCGATGGGGTAAGAATGAAATCCGGCGGCGCGCGCAGCATAAATTCTCGATCC
TTCCTGCTAACACGTCACAGCAATGGCATAAGCTCGTAGAGGCTGACGTCTACGACCAAGCCAAGCTGGATGCATTTGTC
GACGGAAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62