GenePrediction:GLEAN_6995 Details

Name: GLEAN_6995
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:434782..433165 (- strand)
Length: 1618
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:434782..434371 (- strand)
Length: 412
Type: CDS
Source: GLEAN
Position: GCSC_108:434317..433903 (- strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_108:433853..433424 (- strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_108:433356..433165 (- strand)
Length: 192
>GLEAN_6995 class=GenePrediction position=GCSC_108:434782..433165 (- strand)
ATGCATCCAGTCGACTCTCTGCAGACGAAAGCTGTCTCATTTTCGAAACGGCCGGAAACACCCCTTTGGCCCTGTGACGT
TCTGGTCCCGGTCTGCGCGCACGACGGTCCTTTCCTCCATCATCCGGGTGCCCATTCTATCCGCGAGAAGCCGCCAATCG
TGGCAGAGCTGCGGCGTGTCTCCATTTTCTCCGCCCCCCACCACCACCACCACTACCACCACTGCGGCAACCGGCCGAAT
ACGGCGCTCGCATCCATGCCGGCCATGTACGACGTGCCAAAGCCCGGGCCGGCCAATCTGTGGCCAGGCGCCGGACTTGA
CGACTGGCTTGCAGAGGCAAAGCAGTGCCACTATCTGCCCGAGCCGGTCATGAAGCAGCTCTGCGAGATGGTCAAGGAGG
TGCTGATGGAGGGTAAGACCAGGCGTGCGCCCGCTTGGGGCTGGACGACTTGCTGACGGCGCCAGAATCCAACATCCAGC
CGGTGTCGACGCCGGTGACTATCTGCGGCGACATCCACGGCCAGTTCTACGACCTGCTCGAGCTCTTTCGCGTAGCCGGC
GGCATGCCTGGCGAGACGGACGTGCAGGCACCCAAGACGATGACGTCGGTGATCACGTCGGAAGATATCGAGCCGCCCAC
AGAGATCCGCAACCCGCGGCTGCGGAGGAAGCTAAAGGACGGCGGCGGGGCCGCATCCACAGCAGACAACGACGACGCGA
CGGCGACCGGCGACGGGGACAGCCACACGGGCAACACGACCGAGGGCATGTCGGGCACATCGCAGTCGGCCGACACGCGC
TTTGTCTTTCTCGGCGACTTTGTCGACCGCGGGTACTTTAGCCTGGAGACGTTTACGCTGTTGATGTGCCTGAAAGCAAG
GTGCGTCTTGTTCTCTCTTGGCTCCCCCCTGTACCTTCTAACAGTCCAGATACCCCGACCGGATCGTGCTGGTACGTGGC
AACCACGAGTCGCGACAGATCACACAGGTGTACGGGTTCTACGAGGAGTGCCAGCAAAAGTACGGCAACGCGTCGGTGTG
GAAGGCGTGCTGCCAGGTGTTTGACTTTCTGGTGCTGGCGGCGATCGTGGACGGCACGGTGTTGTGTGTGCACGGTGGGC
TGTCGCCCGAGATTCGCACGATCGACCAGATCCGCGTGGTGGCACGGGCGCAGGAGATCCCGCACGAGGGCGCTTTTTGC
GATCTGGTCTGGAGCGACCCCGAGGAGATTGCGACGTGGGCCGTCAGTCCGCGCGGCGCCGGCTGGCTGTTTGGCGATAA
GGTGGCCAACGAGTTCAACCACGTCAATGGACTGACGACGATTGCGCGGGCGCATCAGCTGGTTAACGAGGGCTACAAGG
TCGGTTTTTTTTTTGGGGGGGGGGGGTGGTCTCTGGGGCTGTCGTGCATCCTGCTAACCTGAGCAGTTTCACTTCCCCGA
AAAGTCCGTCGTCACCGTCTGGTCGGCACCCAACTATTGCTACCGGTGCGGCAACGTGGCATCCATCATGACGGTCGACA
ACAATCTCGAGTCCAAGTTCCGCATCTTCTCGGCCGTGCCAGACGAGTTCCGGCACACGCCATTCGACCGACGGGGGCCA
AATGACTACTTCCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62