GenePrediction:GLEAN_6996 Details

Name: GLEAN_6996
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:431740..430488 (- strand)
Length: 1253
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:431740..431559 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_108:431499..430488 (- strand)
Length: 1012
>GLEAN_6996 class=GenePrediction position=GCSC_108:431740..430488 (- strand)
ATGAACCGCTCCACGGACCAGTCGCTGCAGTCGTTGCTGCCGACGCACAACGGCACGTTTTCGCCGCAGCTGACCGACCT
GGCCGGCTCGCTGCTGGCGCAGTCGCGACACCGTGTCAGCACGTTGAAGGCGGACGAGGAGGTTGCGCGACCGTATGCAT
GTGCACACATTGCCTGTGACCGGTGCGTATCCGATGCCCGCGCGTGGTGGACGATGGGCGATGAAGGCTGACGCGAGACA
GGCTCAAGACCGTGCTCAACCTGCCGCCGATCGAGCCGCGTCCACCGATTCAGCCACGACTGTACAAGCGTCTGTACGCG
CATCTCAACACGGTGCTGCAGCCGACACCGGCCCAGCGAGACAACCAGACGCCGCGGAAAGACGGGCCACAACGGGACGT
CGCTGTCGGGACGCCATTCCGCACGGCCACGCCTAAGCGGCGGCCGGCAAGGACGCCACGGCCGACGGCCAAAGGCAGCA
CGACCATCTACAGCCCACAGAAGAGGCCAGGCGGCCCTGCATCGGTGTCTGTGTTGGTGTCCGTGCCGCCGCCTTGGCTG
CGGCCGACGGTCCGGTTCGTGTGCAGCACGCTCGGCCACGCACGCCTGGCGCCCACCGTGGCAGCCGGCCTGTCGGCCAT
CCTGCGAGAGGCAGCCGAGCAGAGCAAAAAGACAGCCAGCAGCGGCGTTGACGACGGCGAGACCGAGCCGGGCAGCCCGG
CCTGGGTGGCGGGCAGCTTGACGGCGCTGGCGGCAACGCTCTACTACTACTGCATCAAGTCGTGGCAGGCCAGCCAGGAT
GTCGGGCCGATGGACAAGACGCAGTACAACACAGACGAGCGGACCATCATGGACGTGTTCCAGAAGGCGCGGGAGGGCGG
CGTGCAGCTGGAGGGCGGCGCCGGCGACGTCTGGGAGAAGACTGGCTGGCACGACCTGACACGACACAGCTTCCGCGAGG
CGCTGCTGGCGGTGTCAGACCGCAAGTGGCTGGAGAGCGACTGGTTCCGCGACATCCAGCAGCTGCGAGACGTGGCCGGC
AGCGACTACAGCGAGGGGGGCGACAGCAACGACAACAACAACGATGACGATGACGATGACGATGCGGCCATTCCCACGCA
CACATGGCGGTCCGACAGCATGTTCCAGGAGCGGTATGACCTGCTCAGCGAGACGCGACGGCAGGACTATGGCGACTGGA
AGAAAGAGATGTTGCAGCGGTTGAGGGAGGGGACGAGAACAGGAGGAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62