GenePrediction:GLEAN_6998 Details

Name: GLEAN_6998
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:422555..421186 (- strand)
Length: 1370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:422555..422403 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_108:422340..421186 (- strand)
Length: 1155
>GLEAN_6998 class=GenePrediction position=GCSC_108:422555..421186 (- strand)
ATGCGTCCCGATCGCGCCAAGGACACGCGGCCCAAGAAGGCCAAGGCCGAGAGTAAGGTCTCTGTGGCGGTGCGCAGCTG
GCTGGCCGCGGTGCTGCCGCAGCTGCCAGTCGACACTGCTGATGCAGTCTCGCCGCTGTCGGAGGAGACGATCGTCAGCC
AGGCACCGAAGCGGTGGACTGTCTACGAACCCATGGTACTACTGCCGACAGGCAGCTTCGGGTCTGCCCCGTGGCCCCGC
CTGCTGGTGGCTGTCTCGGCCGTCCAGCGAGACGCCCTGTGGGGCGGGCAATCCTGGCGGCGCTGTCGCCCGGCTGCGGC
CGGCTGACTCATCTGGCCATCAACGAGGGCATCCCGCTACACATGGATGCCGGTGCTATCAGCGGTGGCGGTGAAGAGAA
CATCTTGCGCAGTCCCACGGGCTTGCGGCCACTGTACGGTGACTTTGGACCAGCCGGGGCAGCGATGGGCTCGGCGCCTT
CGGAGGCCGATTTTGCGGACGCGCTGTGGGTGTCGACACGGCAGAACGGAATCTTGCAGACTTGGGCGCCGCGGTGGTCC
ATGTTCAGCCGGGGCAACATCAAGGAGAAAGCGCGGCTGCTAGCATGGGGTGAAGAGGTTAGGGAAAGTGAAGAGAAGAC
CACGCCGAAAGAAACGACGAGCGAAGCGAGGGAAAAAACAAAAGAAGCGACGAGCAGAGCGAGGGAAAGAAGAGAAAAGA
ATCTCTGGGCCGTTGACCTCTATGCGGGCATCGGCTACTTTGTCTTTTCATATGCCCGGCGCGGCCTGCGCGTGCTCTGC
TGGGAGCTCAACCCGTGGAGCGCCGAAGCACTGCGGCGTGGAGGAGTGCGCAACGGCTGGCAGGTGCGCGTGGTGGGCCC
AGACAAGGGGAACGCAGCCGGAGATGAGGACGAGGAGACGTCTTTCCGCCGACAGACCCTCGACGCGGTCGCAGACGACG
CCATTCAGATCGTTGTGTTTGTCGAGGACAACCGGCACGCAGCCCGACGGCTGGCAGCCCTGCGCAACGCCCACATCCGC
CTGTCGGTGACCCACGTCAACTGCGGGATGCTGCCGACGAGCCGGGACAGCTGGCGGACGGCCTGGGATGCGGTGGCCGA
GGATGTCGGGGTCGGGGAAAACGGGTCCGTCCGAGAATCCGCCTGGCTGCACCTGCACGAGAACGTGGGCGTGGCCGATG
TGGATGCGAGGCGACAAGACATCCAGCAGCTGATGGCCACGTGGGCAGCCGACAGTCCTGGCGTCGCCGGGCAGCTCACC
TTGGCCTGCGTCGAGCACGTCGAGCTCGTCAAGACCTTTGCACCGGGCGTCTGGCACTGCGTGTTTGACGTGCGCATCAC
GCTTCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62