GenePrediction:GLEAN_6999 Details

Name: GLEAN_6999
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:419308..416620 (- strand)
Length: 2689
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:419308..418936 (- strand)
Length: 373
Type: CDS
Source: GLEAN
Position: GCSC_108:418871..418838 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_108:418783..418602 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_108:418184..416620 (- strand)
Length: 1565
>GLEAN_6999 class=GenePrediction position=GCSC_108:419308..416620 (- strand)
ATGGGTACAGCCGAGACGTCAGGCCAGTGTCTTTGCCCAAATGGTCATGGTGCCGCCACGCTCGCTACAGACAGGAAAAA
CGTCAGGGGCATAGAACCTCAACTGCAACACGTCCACGATCTTCCTCGTCGCCAGACCTTTGGTTTTTACGATGGAAGCG
ATCCCCAAGACTGCATCAACAACTGTCGCGAAAGCTTCTTTAGCCTGCTGCTCGACACGCCCCCGTCTGAGGACGACAGC
ACCGATACCACACCTTCAGAGGTCTGCTCGCTTCTCTCGGCCGACGGTATCAGCGACATCCTCTGGCAACTCTACTGGTG
CGACTCGGCCTTTTGCGGCGTCTGGATAGAGGCCGGCACCTCTGGACAGGATCGTGAGTCCAATCTGTAAACAAAACTGT
CCTCTGCTGATGCTGCGCACTGACCTGGCTATGATAGCCAACGTCGACCGCCTCATAAATCAGTGTCAAAAGTGAGAAAA
TGTCAGTCAAATTCCATTTCCTCAGCACTCCTGCTGACGTCACAGCATCGGCTACTCGTCCGTGTACGATCCAGGATCGC
CGGCATCCGACTATTCCTGTAGCAGCCTGCTCATGGCTGTTTCAGCTGGCAACCCATGTTGGAACACGGTCGAAGTATCC
GCAACAAGCACATCGGACAGCAGTATTCTCACATCCCCGGCAGCGGCAATGGCCCCCAGTCTCATTAGTATTCCATCGCC
CGCTCTGACAGCATCAGCAACCGTAACAGCAGTGGCATCGGCAGCGTCACTTCGTAGCACTACTGCCAGCAGCACTCTTC
TTGCAGCCAGTACTGAGGGGACATCGCAGCTTGGCGGCGGCCTCGCCACATCCAGCAAATCTGGCCCGTCACCCGGCATC
AAGGCAGCCGTTGTCGTCAGCGTGATCGTCGGCTTCCTTCTTCTAGCCGGGCTCGTCTTCTTGCTCTGGCGACGGCGCAA
AAGCAGGGGTGGCAACGGCAGTAATATCCGGAGAAACAACAGAAATACCAGAAATATTAGCAACTACAGCAACAATAGTA
GCAACAGCAACAGCCGTATCAAGTCTTGTCTCCAGCAGAGCCAGCTCTACTTCTTTCCCAACAGCCAGCAGCATGCTGGG
GCAGCTGGCGAGCTTCCGACACCGCTTATCTCGCCAGCACGCTCACGCAATTCTGCCGCATCTTCAGCACGGCCGTCGTC
TTTGAATGGCGGGGTTGGTACTTTTGCCACTGCTGCATATGGAGCCTATGGCGGAGGCTCGTCCACCGCTGAGACTTGGC
CGTCCCATCCGCCGCGTGACCATCGACGCGGCCGCAGCAGATTCCTGCCAGCAAGGCTTTTTCGCAGAGACATCAGACGG
GGCACATCACCACCACTGACATCTCTGTCGCCACCACCAAGTCCAACAACCGGCGGTGGTGGTGGTGGAGCCGGGGGCTT
CTATGGCTACACTGACACGTCCATCCCTTACTATTTTCCCAGTTCGCCCAGCTGTGCTCCCACAACAAACAGACTCGAGC
CACGCCGTGAGGCGAAGCCAATGCCCAGAGCCGCCAGACTCAACTTGAGAGAAATGAGGCAGAAGCAGCAGCAGCAGCAA
CAAGAAGAAGAAGAACAGAAAAGCCACGACATCCTCCACAGCTCCCGCCGAGCCGCACCGCCTCCTCCTCCCAGCTCTCT
CATCTCTCTCTCGCTCTCCCTGCCATCCGTGGCAGCTTTGGTGTCTAAAGATGATGGATCCTCGTTTGTCAACAGTGGCA
GGATACCCTCAAAGATCGGTGCAGGCGCTGCTGTGCAGTCCTGCTCTCCGTCTACTCCAATTTCTCCAGCGGCGTCATCG
AGCATCTACGGCCATGCACTGACTACCGACGCCGTCGACCCCATGGTTGTACTGCCTACAGTTGTCTCTCCATACTACAG
TGACGGAGGTGGTCCAGCGTCTGTGTCGCCGGCGTCGGCCCTGTCTGCTCGCAACTTCTCTTCCGGTGTGCCATCGCCAC
CGTCAGCACCACTGCCGTCCCGTCCTCTCTTTCCTCCCATGAGCCCGAGCCGGCCGTCACGGCCTCACGATACACCACTC
GAGATTCCTGACCTCATCATGCCAAGAACGCCACCACCAGTTGGCCCCTTTTATACCAAAACAGCCAGAGTATCGACCTC
GTCGCCTTTCTTCTCGTCCACAGCCTCGCAGAGCGGAGGCAGAGACCGAACCCGGGATAGCAGAGGTGACAGTGACAGCG
ACATTCGTTTCTCTCTCTGTGCACCTCCCGATCGTGCTCTGCCACCACTGCCTTTGCAATCACCTCCGACCTCGCCACCG
AAACAGCCGAGAGACTCCAGTGTAATGCTGACACGGGATGGTGATCCGAACGACGAGGCATGGGCCAGTCAGAAATACCG
GCCGGTTAATACGTCCACAGAGCTGCCAGAAAGTGGCAGCGCCTCGACAGCTGCTGCCGACGGTGTCACGTTCACGTCGT
CCTTCTCATCGGCAGCAACTGCGTCCACGACAAAGTCTACGGGGGTTTTGGGCTATCCAAGCGAAGTGCTATCCACGCCG
TCGTCTCCAGCGTCCGTATACTCGACAGTCACAGACAGCTCGAGTCGGACCGTCCGGAAGGCCATTGACACTCACAGCCG
GATGGCTTTATACGCACCCTCTACATCATCCGAGATACCAGAGAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62