GenePrediction:GLEAN_699 Details

Name: GLEAN_699
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1514420..1515336 (+ strand)
Length: 917
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1514420..1514467 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_97:1514543..1514573 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_97:1514704..1514786 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_97:1514851..1514966 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_97:1515037..1515207 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_97:1515294..1515336 (+ strand)
Length: 43
>GLEAN_699 class=GenePrediction position=GCSC_97:1514420..1515336 (+ strand)
ATGGCAGAGTCGGTGCTTTCTCCCAAGTTCGCGCCCTTCTTCGGCATGGTACGGCGTCCCTCTGTCCTGCCGCTGCCACC
AAAATGACCTGTACGCCAGCTAACGTCCCCCTTCCACGTTCAGGCCGGAATTGCGAGCGCCATGATCCTAGGCTGTACGT
CATGTTTCCGAGCTTTCCCTCGTCCGGCAATCCTTGACAGATGCTCGATATCTCTCTGCGCCTGCAATTCATCTGCTTCC
TCCCTGCAGTGACAATGGATTCTAACATGTATCTTGATCGCTAGGCGTAGGAGCCGCATACGGCACGGCAAAGTCGGGCA
TCGGTATCGCCGGCGTGGGTACCTTCCGGCCAGATCTGATTATGAAGGTGAGCCATGCGTTCTCTGTCGCGATAGGCGAC
TCTTTGCTAACGCAATGTCTTCGTCCTCCAGTGTCTCATTCCCGTCGTCATGTCTGGTATTATTGCCGTCTATGCCCTCG
TCATGGCCGTGCTTATCGCACAGGATCTCGGGCCTCCCAGCTCCGGCTCTAACTACAGCTTGTTCAAGTAAGCCAAGACC
CAGCTCGGGCAAGCCAATAACCGCTACAGCTTGCTGACATGCTATCTTCTCTCTTAGCGGCTTCATGCACCTTGCATGTG
GATTGTCAGTCGGCGCCACCGGACTGGCAGCCGGCTACTGCATCGGCGTCGTGGGCGACAAGGGCGTGCGAGCATACATG
GAGCAGTCGCGAATCTTCGTGGGCATGGTGCTGATCCTTATTTTCGGCGAGGTGCTGGGACTTTATGGGTACGATTGTCC
ACTGTCCACTGCCCTTTCCCTTTATATCTAGGCGCTTGCCTCTTCCACGCTGATCTGGCTAACCAAAGAATCAGACTCAT
TGTTGGACTTATTCTGAACACCAAGAGCAAGGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62