GenePrediction:GLEAN_7000 Details

Name: GLEAN_7000
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:413825..412672 (- strand)
Length: 1154
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:413825..412941 (- strand)
Length: 885
Type: CDS
Source: GLEAN
Position: GCSC_108:412710..412672 (- strand)
Length: 39
>GLEAN_7000 class=GenePrediction position=GCSC_108:413825..412672 (- strand)
ATGGCCGTTTCGCTTCGCCGCAGGAGACCTGTCACAACCTTTGATTTCCACCGCCGTAGAAGGGAGAATGGAAAGGCGGC
AGATTGGCAGATTGGCGGTGGAGTGCCTGCGGGAATACACATCATGCGTGTCCCAGCCTCGAGAAGGGAAGAGGACCAAT
GGCTGTCGACCTGCTCGCTCCCCTTCCTTCTTCGTCCTTCTTTCTCCTTCCCCCCTGGCATCCCCCCTGTGCGGACAGAC
CGCCTTTCCATTTCCCGGCTCGGGCAACGGTCGGTAACAGAGCTACGGCAGAGGCTATATGCCGGCGGAGCCTGCCCGCA
ACGTCTGGTTTTCTTCTTAACCATGTACTCCGTACTGGTGGTCATCTTGTCATCTCGCCCATGCCATCCAGTTCATGCAG
CAGGCCGGCACTACTCCGCAGAGGAGAGGACGGATTGCATTAGCTTCCCCCAGTCTGCAAGATTCGACGTGGAGCGGCGA
CCAGACGGTCTTATTTTCCAGGAAGGAAGATCGAACATGTCTGCGGTATCTTGCATGCTCGTAAGAGAACGCTCACCCCC
CCTGGCCCATGTCAGCTGGACGGCATTCGCTGGCCGTTACCCGACGCTCTCATCCGTTCCTGGATTCCGTTTCGAGTGGG
ATCGAGAGCTTCAGCGCTCCCGAGCTGCAGAGCTGCCCCAAGCAGACGACAACCTCGTGGAAACCCCTCTCCATCTCGCG
GAATATAGGAGAAGGGGCAGGCAGAGGTTGTGTCATCGTGCCATCGTCCTGGTAGCTGGGACGCGGTCACTGGCTGGCAA
CGATCCATCACAAGGCAACATCGTATCACATCCGCAAAGCAGGGACGGACGGTCTGGCCGGCATTTGCTGCTCCTGCTCG
TACTCGTATGTGCGCGGTACACGCAGGACCGGTCGTCTTCCCCTGACAAGGTGGTACAGAGTTGGTATCCGTTGCGGTTA
GTCTTGACCGATCGAGACATGCGTTCAGACGACGCTTGCCCAAAGGGAAGGGGGGTGCATCGAGGCTTTTTGCGGTTGCA
CTACCATGTACGAGTACGGAGTACGTAAGATGAGATCTTCATTGCGAGCGGGCGAGAAAGGCTAATCAAAGCCAGACTAT
GCATCTGCTGCTCCATATGTACGAGTACGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62