GenePrediction:GLEAN_7001 Details

Name: GLEAN_7001
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:392310..390844 (- strand)
Length: 1467
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:392310..392113 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_108:392035..391956 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_108:391903..390844 (- strand)
Length: 1060
>GLEAN_7001 class=GenePrediction position=GCSC_108:392310..390844 (- strand)
ATGCAGAGCTTCAATCGCAAGTCGGATTTGCAAAGGCATTACCGCATTCACACCAATGAGCGGCCCTACCAGTGCAACAC
GCCTGGCTGCGGCAAAAGCTTCATCCAGCGCAGTGCTCTGACTGTCCATATCCGCACACACACGGGGGAGAAACCACACA
TGTGTCAGCATGCTGGATGCAACAAGCGCTTCTCTGATGTTTGTGCCCCCAACGCTATTTTTGCGCAGCTATACATGCCC
TTTTCGAAACGCTGTGGCTGACCTCAACTTTACAGTCGTCGAGTTTGGCTCGCCACCGCCGTATTCATACCGGAAAGCGG
CCGTACAAGTGTGCCCACGATGGCTGCTTGAAGAGGTAAGCAGTTTCTCACCCTGACACGGTTTGCTTTTCTTTCTAACT
GTCTCAGCTTCTGCCGCAAGACGACTATGGTTAAGCACCAACGGCGATCGCACCAGCGCGGCATCCACTCGTCTGAATTG
GACGACTGTACCTCGGAATCTGGCAGCGATGAGTCGCCATCGACGCCCAAGAGCAATACCATGTACTGGTCGCCACCGCA
GGGCTTGGCCGTTGGCCCTATGGTGCAGCATCCGGGCCATGCCGTCCACCGTGCGGCATCTTTTGCCGACTTCGGCCAGC
ACGTTAACTACGACATGGCACCATACGCCTCGGCCCATCGCCACAGCATTTCGACTGCGCCAAACGACTTCAACGGGCAA
CCAGTGCACCATCCAAATGCCGCCAACGCTTCTGCTGCCGGTGTCGCCATTGTCTCTACAGCCATGGCGCCGCACAACGC
CGGGATGACGATTCTGCACCGGACGGGCAGCATGCCCCAACATCCGTATTATGTGACTGATCAGAATAACCCGGGCGTTG
CGACGATGAATCCGAATGCCCACCTCACGGCTCAGTATCACCAGATGCCACGACAGTCGCTAGAGCGTGTGGCCATGGAC
ATCCCGTACTCGACGACGCCTGGCCTGGCTACATCTATACAGAGTAGCCCTAGCAGCTACTCTACTGCTGGTCGCAGCCC
GTCCACCCAAGACAGCTTCTACACACACCAGGCAACACAAGCAGCAACCTATGCGCTGCATTCCGCGTCACCGATCGAGA
ACCAGGCCACGCTCGGTCACTACCCGCCACATCAGGGACCACAGCAAGGCACCCAGGCACATCATGCTGCTGCCCAGACA
GCGCCGGGCGCCCACGAACAATATGTACAGCACCATCAGCCGCAATCGCAGATGCCACAACCGCAGATAACACACTCGCA
GCCGCAATCACATGTGGTTGAGGAGCAGTGGTACAACGGGGTGCCGTATCAGCAGCCGGTCGAGGTGCCGCAGATGCCGC
AGCTTTCGGCCTACGGCTCGACGGTGTATGATCCGTGGGGCGACGCCAAGATCGAATTCGAAACCGCGGGCATACAGATG
CCGAGTGCGCGCATCGAGCAGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62