GenePrediction:GLEAN_7002 Details

Name: GLEAN_7002
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:386881..385723 (- strand)
Length: 1159
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:386881..386503 (- strand)
Length: 379
Type: CDS
Source: GLEAN
Position: GCSC_108:386442..386298 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_108:386230..385723 (- strand)
Length: 508
>GLEAN_7002 class=GenePrediction position=GCSC_108:386881..385723 (- strand)
ATGGTCACTAAACGGAATACTCGCTCCTTCGTGGCCGAGGAGCTTACTGCTGACGAGCGCGATATCCAGCTCTGCCAGAC
ACAGAGTGCGGCTCTTCGTAAGGGCAGCACTCCCAACCTACTGGAGAGCTTCCCAGAAAAGGACGTCAGCAACAGCATCA
TCCACGGCACCAGTAACGGAACATGCACAAGCAGCAGCAGTCCTGCTTTAGACGACCTGCCAATCGCCGTGAACCTGCCT
ACGATGGAACGCACTACGTCCTTGTCTAGCAGCAAGAGCAGCAGCGGTGCCAGCTATTCATCGTCGGCGTACTCCTCTGC
CTCGTCCAACGCATCCGAAGCTTTTCTGAGCGCTGCGGACTCAGGTCTGCTTGCGGAAGGTAATTAGCCCGCCCCTCGAC
CCCTACTTACCCCTGTCAACACCTGCTGACACATACAAGAAATTACGTCTCCCCATCAGAGCGCGAACATTGCTGTTGGG
GCACCGCTCAACTTTGGCCAGGTTGTCTCAGGCCTATACCGGAGCAGCTATCCCCAGCCGGAGAATTACGCTTATCTGAA
GAGCCTGGGCCTGAAGACGATTGTGTATGTGTTTCTTGTTTCCAACAGGCTAAAGATTCTTGACGCGCCATGGCGCTAAC
GAGAAACACAGCACACTGGTGGACAAGAATTTCACGGAAGGCTATCAGAAGTTTATGAGTGCCAACAACATACAGCACCA
TGTGTTTGGCATGAAGGGCACAAAGAAGGAGGAGATCCCTCTTTCGACCATGGAGGCGATTCTCCGCCTGGTGCTGAACC
GTCAGAACTACCCGCTTCTGATTCACTGCAATCACGGAAAGCATCGGACAGGATGCGTTGTGGCTGTGGTGCGCAAGATT
TGCGGCTGGAACAACGAGCGGATCGTGCACGAGTACCGGACATACGCAGGCATCAAAGAGCGTGACTGTGATGTCAAGTA
CATGCGTGCCTTTGAGTTGTCGCACATTGCGTCGCTGGTCGCAGACGAGACACTGCATGTGGACGAAGGCCCAGCCCAGT
CAGCTGCTGTTGGCTTCCGCGTGCCACACTTTCTTCGTGCCGCTTTTGTTTCCATGACGGTGCTGTTCATCTGGATGATC
TCCGGGTCGAAGATGCAGCAGCACCACAGACGGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62