GenePrediction:GLEAN_7004 Details

Name: GLEAN_7004
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:381363..378277 (- strand)
Length: 3087
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:381363..378817 (- strand)
Length: 2547
Type: CDS
Source: GLEAN
Position: GCSC_108:378312..378277 (- strand)
Length: 36
>GLEAN_7004 class=GenePrediction position=GCSC_108:381363..378277 (- strand)
ATGGTCACCCGAAAGCCTGTGCCGAGCTCGTTCTACGCGGGCGGCGGCACATCGGACGGCCTGCCAGAAAATCTGCGGCC
GGCCGTCGGAAAGCCTGCTGGTGGCGCGGACGGCGAGCGGAGCGCATCGCCAATCGCCTTCTCGGGCTTTGAGGAGGAGG
AAGAAAACGCCTGGCGGCAGCAGCAGCCAGCCAGAGCGATGGGGCAACAACAGCAGCTGCAGCAGCAGCATAACGATATG
GCATCGTCTGCCGTAGCAGGCGTGCCTGTAGTATTGCCCCCCGACGGCGATGCCGGCGTCCTGATCGAGACGAACCCGTT
CAAGAAGAAGCTGCTGGCACCGGTGCCGGGCACGAATCCATGGCAGCCCGAAGAAGATGAGCGCAACTGCAGCCTTGGAA
CGCTCAACGTGGAGGCTCCGCAGATCGTGCTCTCGGATGACACGGCAGCCGGTGGCGTGAGCGGCGTCTGGGGATCGGTT
CCTAGCGCGTCCGGACAGCCGCCAGGCAAGCCGTCGCTGGGGCCCAAGGCAGCGCGGCCCGAGTCGAACCTGCTCATATT
CGAGCCTGGCGAGGAAACGGAGCGCGCGGCGTGGGACGAGGTGGCCTCGGTGGCTTCGACGGCCCTTCCGCCAGAGCGGG
CACCACCATTGCGTCCGACCAGCGCGCTTGGCGGCAAGGCCGGCGAAGAGAGCGAGGAGGCATACGAGAGCCGTCATGCG
TGGGACGACGTGGGCGGTAGCAAGCAGGCGACGACAGCCGTGGCTGTAGCGAGTCCTCTCGCGGGGGCAGAGGAGGCTGC
CGGAGAGGGCTGGAGCATGGTGGACGACCAGGTCGGACCAGGGCAGCTTTCGAGGCAGAGCACATGGGAGAACTTTACGG
ACGACGAAGAGGGGGGAAACGAGAGCAGGAAGGGAAAGGTGGTGGACACGACAGAAACATCGACAGCTGTAACAGTAGCA
ACAGCAACAGCAGCAACAGCAGGGCAGCCGGAACTCAGCATCACGCCAGCGGAGGTGGTCAAGAAAGTACACGTGCAAGG
TCCGGTCAGAAGCCTGCTGGACATTGACGACTCAGGGCCACCACCACCACCGCCACGACCAGCAGAAGGTGACAAGACAG
AGACGTACCAGATCAAAAAGGTACGGTGGCACGACGCTCAGGCGAGCAAGAATCCGCGAGTGTCGCCGATCCTGGTTCAG
AATCGGAATGGACCGTGTCCGCTGGTGGCGCTGGTGAACGCGCTGACGCTGACGACGCCGGCAGACGTGCAGACGGCACT
GGTGGAAACGCTGCGGTCACGCGAGCAGGTCAGCCTGGGGCTGCTGCTAGACGCAGTGTTTGACGAGCTCATGTTTGCGC
GACGGGGCTCGGCGACGGGCTCGCTGCCGGACGTGGACGAGCTGTACGGATTTCTAAAGGGACTACACACAGGCATGAAC
GTGAACCCGCGCTTCATCCCGACAGCAGAGGCAACGGCGGCCTTCCGACGCACATCGCCCGATCACGTGACTCCGACCGG
ACGCAGCGAGCGGCCGATGCCGGGCACGTTTGAGGAGACGCGCGAGATGCAGCTGTACGCGACGTTTGGGATCACGCTAG
TGCACGGCTGGCTGCCCTCGCACGACGAGCCGGTGTACGGAGCGATGGAGCGCCACGCGGCTTCGTACGACAGCGCGCAG
AACCTGCTGTTCCGCGAGGAGGAGCTGGACCAGAAGCTGAGCAGCGCGACGGGCGACGGACTGACGGACGACGAGCAGGC
GCTCTACCAGGACATCCTTCACCTCAAAGCCTTCTTCCGCTCGTCGGCCACGCAGCTGACGGCCTCGGGGCTCGAGGTGC
TGGCCGCGTCGATGCAGCCGGGTGCCATCGCCATCCTCTTCCGCAATGACCATTTCTCGACCCTGTACCGACACCCGCAG
ACGATGCAGCTGCTGTCGCTCGTGACCGACGCCGGCTATGCCGGCCACGACGAGATCGTCTGGGAAACCCTGGTCGATGT
GAACGGCGAGCGTGCCGAGTTCTATTCGGGCGACTTCCGGCTGGTCGGCGGGGCCAGCCAGCAGGGGATGGAAGTGGGAG
CCGGAGCCGGAGCCGGAGCCGGAGCCGGAGCTGGAGCTGGAGCCGGAGCTGGATTGGCCACGATGGTGTCGCCAGACAGA
CAGAGCAGCCAGGACCGGTCGAGCGGACAGAACGACGACAGCCACCAAGGGCTGCCTGCCATTGCCATCTCCAAGCACGA
GCAGGAGGACCGGGACCTCGCCTTTGCCCTGCAGCTGCAAGAAGAAGAAGAGGAGCGCGAACGGGCCGAAACAGAGCGCC
GCAAGCGTGAGAGCCAGCTGTCGGAGCAGTTTATCGAGCAGCAGGGAAAGACCGTATCTGGCAGCCCTGGATCTGGATCT
GGTCCCAGTCGCAGCCGGCCGACCGCCAGCAACGCAGCCGGCGGCGGTCTCTACAGCAGCGCGCAACAGCAGTCGGTGGC
CGTCTCGCCGCGACGAAGCTCGGCTGCCGTCAGCAACAACAGCAACAACAGCAGCAGCAGTGTCGCCGTCACCAGTCCGG
CTCGCTATCGTGGACAGACACAGCCGACGTCGGGATCGCCTCGGCCACAGCCACAAGCACAGCCACAAGCACAATCGCCA
CAGCCACAGCCACAGCTGCAGCTGCCGCCACAACTGCCGCTGCGACTACAGCAGCAGGTCCGGCCCCTGGTGCCGCCGCT
CGGCAGCACCTCCTCCGTCTCCCTCCGGGCCACCAGTCCTCGTCCGCCCGTCCATCGGCCGACCAACGAGGAGGACGACG
ACGAGGCTCCGCCGTCTTACGAACAGGCGGCCAAGCAGGCACCGTACCATCCGCCGTCCGAACAGCAGCAGCAGCTCCTG
CAACAACAACAACAACGACAACAACAACAGCAACGGCAGCAGCAACGACAGCAGCAACGAGAGCAGCAACAACAAGGAGC
GCCACTGATCGGCCGGCCGCAACCACTGCTGCCGCCACAGCTGTTCCAGCAGCAGCAGCAGTACCACCAACAGCAGTTTC
AGCAGGCGCAGATGAGGGAACGCGATCGCGAATGTGTCGTCATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62